Incidental Mutation 'R2224:Vmn2r100'
ID241576
Institutional Source Beutler Lab
Gene Symbol Vmn2r100
Ensembl Gene ENSMUSG00000091859
Gene Namevomeronasal 2, receptor 100
SynonymsEG627537
MMRRC Submission 040225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2224 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19504732-19535231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19522372 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 336 (K336R)
Ref Sequence ENSEMBL: ENSMUSP00000128350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166081] [ENSMUST00000231465]
Predicted Effect probably benign
Transcript: ENSMUST00000166081
AA Change: K336R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128350
Gene: ENSMUSG00000091859
AA Change: K336R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 456 7.4e-41 PFAM
Pfam:NCD3G 510 563 1.9e-21 PFAM
Pfam:7tm_3 594 831 2.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231465
AA Change: K336R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,472,068 L1416R probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Ahnak G A 19: 9,012,991 probably benign Het
Ar T A X: 98,151,331 M517K probably benign Het
Arsb T A 13: 93,794,171 F216I probably damaging Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BC051142 C A 17: 34,448,763 probably null Het
Brinp3 C T 1: 146,901,920 Q702* probably null Het
Btbd9 C A 17: 30,527,346 A169S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep250 A C 2: 155,991,817 E1886D possibly damaging Het
Chd9 A C 8: 91,011,285 H1515P probably benign Het
Cyp2c68 A G 19: 39,735,582 C213R probably benign Het
Ddx41 G A 13: 55,531,401 T544I probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Eea1 T A 10: 96,020,012 V637D probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exo1 A G 1: 175,886,688 probably null Het
Fbxo21 T G 5: 118,008,123 Y597D probably damaging Het
Fbxw20 G C 9: 109,233,582 Q59E possibly damaging Het
Fpr3 T A 17: 17,971,193 V242D probably damaging Het
Fyb A G 15: 6,652,383 Y737C probably damaging Het
Gm17661 GG GGG 2: 90,917,708 noncoding transcript Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17f A G 1: 20,779,375 V55A probably damaging Het
Inpp1 T A 1: 52,790,131 E243V probably benign Het
Leap2 A G 11: 53,422,807 L46P probably damaging Het
Map4k3 A T 17: 80,630,454 D339E probably benign Het
Met A G 6: 17,563,722 probably null Het
Mgam G T 6: 40,764,274 probably null Het
Mrgpra1 A G 7: 47,335,106 V275A possibly damaging Het
Mrgprx2 T A 7: 48,482,860 Q70L probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Mup18 G T 4: 61,671,891 F133L possibly damaging Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nin A T 12: 70,061,230 I196N probably damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Odc1 A G 12: 17,547,335 I13V probably benign Het
Olfr1024 T A 2: 85,904,755 I100F probably benign Het
Olfr1200 A T 2: 88,767,586 M243K possibly damaging Het
Olfr1377 T C 11: 50,985,232 F177S probably damaging Het
Pard3 A G 8: 127,359,776 I286V probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Prpf40b C T 15: 99,303,291 probably benign Het
Rnmt C T 18: 68,305,783 probably benign Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sirt2 A G 7: 28,772,212 probably null Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uqcrc2 T A 7: 120,641,714 V73E probably damaging Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zbtb4 C T 11: 69,776,358 T163I probably benign Het
Other mutations in Vmn2r100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Vmn2r100 APN 17 19526000 missense probably damaging 1.00
IGL00912:Vmn2r100 APN 17 19531392 missense possibly damaging 0.95
IGL01107:Vmn2r100 APN 17 19521356 missense probably damaging 1.00
IGL01517:Vmn2r100 APN 17 19521963 missense probably benign 0.37
IGL01594:Vmn2r100 APN 17 19531233 missense possibly damaging 0.52
IGL01657:Vmn2r100 APN 17 19525916 missense possibly damaging 0.89
IGL01822:Vmn2r100 APN 17 19504838 missense probably null 0.00
IGL02020:Vmn2r100 APN 17 19504938 missense possibly damaging 0.78
IGL02060:Vmn2r100 APN 17 19521254 missense possibly damaging 0.79
IGL02126:Vmn2r100 APN 17 19521242 splice site probably benign
IGL02142:Vmn2r100 APN 17 19522321 missense probably damaging 1.00
IGL02308:Vmn2r100 APN 17 19521335 missense possibly damaging 0.90
IGL02407:Vmn2r100 APN 17 19521508 missense probably damaging 0.98
IGL02469:Vmn2r100 APN 17 19531285 nonsense probably null
IGL03088:Vmn2r100 APN 17 19522039 missense probably benign 0.27
IGL03181:Vmn2r100 APN 17 19531945 missense probably damaging 1.00
IGL03405:Vmn2r100 APN 17 19531924 missense probably damaging 1.00
H8562:Vmn2r100 UTSW 17 19521490 missense possibly damaging 0.87
R0012:Vmn2r100 UTSW 17 19504874 missense probably benign
R0012:Vmn2r100 UTSW 17 19526034 missense probably damaging 0.99
R0044:Vmn2r100 UTSW 17 19522179 missense possibly damaging 0.46
R0109:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0111:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0112:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0149:Vmn2r100 UTSW 17 19521247 critical splice acceptor site probably null
R0355:Vmn2r100 UTSW 17 19531320 missense probably benign 0.00
R0395:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0396:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0453:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0465:Vmn2r100 UTSW 17 19531530 missense probably damaging 0.98
R0477:Vmn2r100 UTSW 17 19522514 missense probably benign 0.00
R0510:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0512:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0514:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0518:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0521:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0555:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0608:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0959:Vmn2r100 UTSW 17 19523524 missense possibly damaging 0.95
R1114:Vmn2r100 UTSW 17 19531999 missense probably damaging 1.00
R2027:Vmn2r100 UTSW 17 19522072 missense probably benign 0.02
R2049:Vmn2r100 UTSW 17 19522050 missense probably benign 0.00
R2226:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R3618:Vmn2r100 UTSW 17 19523430 missense probably benign
R3715:Vmn2r100 UTSW 17 19532010 missense probably damaging 0.99
R4120:Vmn2r100 UTSW 17 19531953 missense probably damaging 1.00
R4152:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4153:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4154:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4200:Vmn2r100 UTSW 17 19522535 missense probably benign 0.29
R4632:Vmn2r100 UTSW 17 19531954 missense probably damaging 1.00
R4720:Vmn2r100 UTSW 17 19522526 missense probably benign 0.02
R4761:Vmn2r100 UTSW 17 19521368 missense possibly damaging 0.47
R4831:Vmn2r100 UTSW 17 19521410 missense probably benign 0.28
R4951:Vmn2r100 UTSW 17 19532038 missense probably benign 0.01
R5211:Vmn2r100 UTSW 17 19525995 missense possibly damaging 0.67
R5553:Vmn2r100 UTSW 17 19504848 missense possibly damaging 0.64
R5657:Vmn2r100 UTSW 17 19504916 missense probably benign 0.31
R5883:Vmn2r100 UTSW 17 19523524 missense probably benign
R5912:Vmn2r100 UTSW 17 19531809 missense probably damaging 0.99
R6141:Vmn2r100 UTSW 17 19522314 missense probably benign 0.07
R6146:Vmn2r100 UTSW 17 19522260 missense probably benign 0.04
R6500:Vmn2r100 UTSW 17 19522093 missense probably damaging 1.00
R6575:Vmn2r100 UTSW 17 19521409 missense probably benign 0.12
R6647:Vmn2r100 UTSW 17 19522523 missense probably benign 0.00
R7038:Vmn2r100 UTSW 17 19505001 missense possibly damaging 0.76
R7052:Vmn2r100 UTSW 17 19531294 missense possibly damaging 0.95
R7170:Vmn2r100 UTSW 17 19531971 missense probably benign 0.00
R7209:Vmn2r100 UTSW 17 19531314 missense not run
R7312:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
R7734:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
R7750:Vmn2r100 UTSW 17 19522464 missense probably benign
X0062:Vmn2r100 UTSW 17 19531390 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTGACATTGATTCTCTAGAAGGTC -3'
(R):5'- TGTGAGCCACAGCATATACAC -3'

Sequencing Primer
(F):5'- ACATTGATTCTCTAGAAGGTCTAGTG -3'
(R):5'- GTGAGCCACAGCATATACACCATTG -3'
Posted On2014-10-15