Incidental Mutation 'R0166:Fubp1'
ID24158
Institutional Source Beutler Lab
Gene Symbol Fubp1
Ensembl Gene ENSMUSG00000028034
Gene Namefar upstream element (FUSE) binding protein 1
Synonyms9530027K12Rik, FBP, Fubp, Fubp4
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location152210422-152236826 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 152220204 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 264 (Y264*)
Ref Sequence ENSEMBL: ENSMUSP00000143354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106121] [ENSMUST00000166984] [ENSMUST00000196062] [ENSMUST00000196429] [ENSMUST00000196695] [ENSMUST00000196739] [ENSMUST00000198227] [ENSMUST00000199202] [ENSMUST00000199876] [ENSMUST00000200452] [ENSMUST00000200524]
Predicted Effect probably null
Transcript: ENSMUST00000106121
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000101727
Gene: ENSMUSG00000028034
AA Change: Y263*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 571 599 1.3e-7 PFAM
Pfam:DUF1897 600 624 1.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166984
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000130145
Gene: ENSMUSG00000028034
AA Change: Y263*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196062
SMART Domains Protein: ENSMUSP00000143718
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 5e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196429
SMART Domains Protein: ENSMUSP00000143478
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
KH 1 69 1.1e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196695
AA Change: Y264*
SMART Domains Protein: ENSMUSP00000143729
Gene: ENSMUSG00000028034
AA Change: Y264*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 7e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.2e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.3e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.1e-4 PFAM
Pfam:DUF1897 601 625 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196739
AA Change: Y264*
SMART Domains Protein: ENSMUSP00000143101
Gene: ENSMUSG00000028034
AA Change: Y264*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 568 596 1e-7 PFAM
Pfam:DUF1897 597 629 4.7e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198227
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000143370
Gene: ENSMUSG00000028034
AA Change: Y263*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 94 164 6.9e-20 SMART
KH 179 251 1.5e-19 SMART
KH 269 339 8.1e-19 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 7.2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199199
Predicted Effect probably null
Transcript: ENSMUST00000199202
AA Change: Y284*
SMART Domains Protein: ENSMUSP00000143204
Gene: ENSMUSG00000028034
AA Change: Y284*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 1e-8 PDB
KH 115 185 6.9e-20 SMART
KH 200 272 1.5e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199876
AA Change: Y264*
SMART Domains Protein: ENSMUSP00000143618
Gene: ENSMUSG00000028034
AA Change: Y264*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.5e-7 PFAM
Pfam:DUF1897 601 625 1.5e-9 PFAM
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199918
Predicted Effect probably benign
Transcript: ENSMUST00000200056
Predicted Effect probably null
Transcript: ENSMUST00000200452
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000143019
Gene: ENSMUSG00000028034
AA Change: Y263*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200524
AA Change: Y264*
SMART Domains Protein: ENSMUSP00000143354
Gene: ENSMUSG00000028034
AA Change: Y264*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 6.9e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.1e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.2e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 571 599 1.5e-4 PFAM
Pfam:DUF1897 600 632 7e-10 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single stranded DNA-binding protein that binds to multiple DNA elements, including the far upstream element (FUSE) located upstream of c-myc. Binding to FUSE occurs on the non-coding strand, and is important to the regulation of c-myc in undifferentiated cells. This protein contains three domains, an amphipathic helix N-terminal domain, a DNA-binding central domain, and a C-terminal transactivation domain that contains three tyrosine-rich motifs. The N-terminal domain is thought to repress the activity of the C-terminal domain. This protein is also thought to bind RNA, and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. Aberrant expression of this gene has been found in malignant tissues, and this gene is important to neural system and lung development. Binding of this protein to viral RNA is thought to play a role in several viral diseases, including hepatitis C and hand, foot and mouth disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit pre- and perinatal lethality, cerebral hyperplasia, pale liver, hypoplastic lungs, spleen, thymus and bone marrow, cardiac hypertrophy, placental distress, small size, and anemia associated with variable, multilineage hematopoietic deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Fubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Fubp1 APN 3 152222234 missense probably damaging 0.97
IGL01328:Fubp1 APN 3 152220218 missense probably damaging 1.00
IGL01583:Fubp1 APN 3 152215624 missense possibly damaging 0.71
IGL02886:Fubp1 APN 3 152220755 missense possibly damaging 0.90
R0268:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0344:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0759:Fubp1 UTSW 3 152210637 small insertion probably benign
R1159:Fubp1 UTSW 3 152215592 missense possibly damaging 0.93
R1194:Fubp1 UTSW 3 152231969 frame shift probably null
R1687:Fubp1 UTSW 3 152228201 unclassified probably benign
R1818:Fubp1 UTSW 3 152222169 missense probably damaging 1.00
R3880:Fubp1 UTSW 3 152220496 missense probably damaging 1.00
R4247:Fubp1 UTSW 3 152231936 missense possibly damaging 0.92
R4564:Fubp1 UTSW 3 152222936 nonsense probably null
R4776:Fubp1 UTSW 3 152222068 intron probably null
R4793:Fubp1 UTSW 3 152223329 missense possibly damaging 0.86
R4825:Fubp1 UTSW 3 152217890 splice site probably null
R5035:Fubp1 UTSW 3 152214851 missense probably benign 0.01
R5167:Fubp1 UTSW 3 152221352 missense possibly damaging 0.67
R5819:Fubp1 UTSW 3 152220553 missense probably damaging 1.00
R5892:Fubp1 UTSW 3 152218314 intron probably benign
R6254:Fubp1 UTSW 3 152232408 missense possibly damaging 0.66
R6814:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R6872:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R7132:Fubp1 UTSW 3 152232024 critical splice donor site probably null
R7612:Fubp1 UTSW 3 152218015 missense possibly damaging 0.66
R7876:Fubp1 UTSW 3 152232291 missense unknown
R7903:Fubp1 UTSW 3 152214861 nonsense probably null
R7959:Fubp1 UTSW 3 152232291 missense unknown
R7986:Fubp1 UTSW 3 152214861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTGACCCATACAAAGTTCAGGTAAG -3'
(R):5'- CAACAGCAAATCTTGGAATTGGGACC -3'

Sequencing Primer
(F):5'- ACAAAGTTCAGGTAAGCTTCAC -3'
(R):5'- CTTGGAATTGGGACCTTAAGTAAAAG -3'
Posted On2013-04-16