Incidental Mutation 'R2224:Map4k3'
ID241581
Institutional Source Beutler Lab
Gene Symbol Map4k3
Ensembl Gene ENSMUSG00000024242
Gene Namemitogen-activated protein kinase kinase kinase kinase 3
Synonyms
MMRRC Submission 040225-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2224 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location80580512-80728093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80630454 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 339 (D339E)
Ref Sequence ENSEMBL: ENSMUSP00000025089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025089] [ENSMUST00000112389]
Predicted Effect probably benign
Transcript: ENSMUST00000025089
AA Change: D339E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025089
Gene: ENSMUSG00000024242
AA Change: D339E

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 874 2e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112389
AA Change: D339E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108008
Gene: ENSMUSG00000024242
AA Change: D339E

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 876 1.39e-114 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,472,068 L1416R probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Ahnak G A 19: 9,012,991 probably benign Het
Ar T A X: 98,151,331 M517K probably benign Het
Arsb T A 13: 93,794,171 F216I probably damaging Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BC051142 C A 17: 34,448,763 probably null Het
Brinp3 C T 1: 146,901,920 Q702* probably null Het
Btbd9 C A 17: 30,527,346 A169S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep250 A C 2: 155,991,817 E1886D possibly damaging Het
Chd9 A C 8: 91,011,285 H1515P probably benign Het
Cyp2c68 A G 19: 39,735,582 C213R probably benign Het
Ddx41 G A 13: 55,531,401 T544I probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Eea1 T A 10: 96,020,012 V637D probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exo1 A G 1: 175,886,688 probably null Het
Fbxo21 T G 5: 118,008,123 Y597D probably damaging Het
Fbxw20 G C 9: 109,233,582 Q59E possibly damaging Het
Fpr3 T A 17: 17,971,193 V242D probably damaging Het
Fyb A G 15: 6,652,383 Y737C probably damaging Het
Gm17661 GG GGG 2: 90,917,708 noncoding transcript Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17f A G 1: 20,779,375 V55A probably damaging Het
Inpp1 T A 1: 52,790,131 E243V probably benign Het
Leap2 A G 11: 53,422,807 L46P probably damaging Het
Met A G 6: 17,563,722 probably null Het
Mgam G T 6: 40,764,274 probably null Het
Mrgpra1 A G 7: 47,335,106 V275A possibly damaging Het
Mrgprx2 T A 7: 48,482,860 Q70L probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Mup18 G T 4: 61,671,891 F133L possibly damaging Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nin A T 12: 70,061,230 I196N probably damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Odc1 A G 12: 17,547,335 I13V probably benign Het
Olfr1024 T A 2: 85,904,755 I100F probably benign Het
Olfr1200 A T 2: 88,767,586 M243K possibly damaging Het
Olfr1377 T C 11: 50,985,232 F177S probably damaging Het
Pard3 A G 8: 127,359,776 I286V probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Prpf40b C T 15: 99,303,291 probably benign Het
Rnmt C T 18: 68,305,783 probably benign Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sirt2 A G 7: 28,772,212 probably null Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uqcrc2 T A 7: 120,641,714 V73E probably damaging Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zbtb4 C T 11: 69,776,358 T163I probably benign Het
Other mutations in Map4k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Map4k3 APN 17 80636718 critical splice donor site probably null
IGL01329:Map4k3 APN 17 80644184 missense probably benign
IGL01626:Map4k3 APN 17 80605809 missense probably damaging 0.97
IGL01896:Map4k3 APN 17 80613931 missense probably benign 0.13
IGL02021:Map4k3 APN 17 80609826 missense probably damaging 1.00
IGL02585:Map4k3 APN 17 80653919 splice site probably benign
IGL03101:Map4k3 APN 17 80655855 critical splice donor site probably null
IGL03231:Map4k3 APN 17 80597675 missense probably damaging 1.00
IGL03267:Map4k3 APN 17 80664028 missense probably damaging 1.00
maple_forest UTSW 17 80603998 missense probably benign 0.38
R0084:Map4k3 UTSW 17 80655914 missense possibly damaging 0.91
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0612:Map4k3 UTSW 17 80602193 missense probably damaging 1.00
R0842:Map4k3 UTSW 17 80605983 missense probably benign 0.35
R2009:Map4k3 UTSW 17 80664088 splice site probably benign
R3851:Map4k3 UTSW 17 80644323 splice site probably benign
R4049:Map4k3 UTSW 17 80605965 missense probably benign 0.10
R4151:Map4k3 UTSW 17 80644534 missense probably damaging 1.00
R4345:Map4k3 UTSW 17 80597551 critical splice donor site probably null
R4405:Map4k3 UTSW 17 80615015 critical splice donor site probably null
R4450:Map4k3 UTSW 17 80603982 critical splice donor site probably null
R4970:Map4k3 UTSW 17 80653903 missense probably benign 0.00
R5230:Map4k3 UTSW 17 80615170 missense probably benign 0.00
R5459:Map4k3 UTSW 17 80609787 missense probably damaging 1.00
R5568:Map4k3 UTSW 17 80663998 missense possibly damaging 0.96
R5635:Map4k3 UTSW 17 80613495 missense possibly damaging 0.94
R5827:Map4k3 UTSW 17 80593283 critical splice donor site probably null
R5927:Map4k3 UTSW 17 80613919 missense probably benign 0.06
R5951:Map4k3 UTSW 17 80603998 missense probably benign 0.38
R5964:Map4k3 UTSW 17 80644762 missense probably damaging 1.00
R6849:Map4k3 UTSW 17 80630413 critical splice donor site probably null
R6985:Map4k3 UTSW 17 80636732 missense probably damaging 1.00
R7040:Map4k3 UTSW 17 80680915 missense probably damaging 0.98
R7233:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7511:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7672:Map4k3 UTSW 17 80615071 missense possibly damaging 0.58
R7680:Map4k3 UTSW 17 80581876 missense probably benign 0.02
R7804:Map4k3 UTSW 17 80615070 missense probably damaging 0.98
X0023:Map4k3 UTSW 17 80593091 missense probably benign
Z1176:Map4k3 UTSW 17 80618337 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CATGGCACTTTCCCTAGTGG -3'
(R):5'- CCCCACTACTGCATGCATAG -3'

Sequencing Primer
(F):5'- GCCAGCATTTAAAACAGTCAATCAG -3'
(R):5'- GCATGCATAGATTAAAATATCACACC -3'
Posted On2014-10-15