Incidental Mutation 'R2224:Cyp2c68'
ID241585
Institutional Source Beutler Lab
Gene Symbol Cyp2c68
Ensembl Gene ENSMUSG00000074882
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms9030012A22Rik
MMRRC Submission 040225-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2224 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39688834-39741054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39735582 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 213 (C213R)
Ref Sequence ENSEMBL: ENSMUSP00000097071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099472]
Predicted Effect probably benign
Transcript: ENSMUST00000099472
AA Change: C213R

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097071
Gene: ENSMUSG00000074882
AA Change: C213R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-150 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,472,068 L1416R probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Ahnak G A 19: 9,012,991 probably benign Het
Ar T A X: 98,151,331 M517K probably benign Het
Arsb T A 13: 93,794,171 F216I probably damaging Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BC051142 C A 17: 34,448,763 probably null Het
Brinp3 C T 1: 146,901,920 Q702* probably null Het
Btbd9 C A 17: 30,527,346 A169S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep250 A C 2: 155,991,817 E1886D possibly damaging Het
Chd9 A C 8: 91,011,285 H1515P probably benign Het
Ddx41 G A 13: 55,531,401 T544I probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Eea1 T A 10: 96,020,012 V637D probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exo1 A G 1: 175,886,688 probably null Het
Fbxo21 T G 5: 118,008,123 Y597D probably damaging Het
Fbxw20 G C 9: 109,233,582 Q59E possibly damaging Het
Fpr3 T A 17: 17,971,193 V242D probably damaging Het
Fyb A G 15: 6,652,383 Y737C probably damaging Het
Gm17661 GG GGG 2: 90,917,708 noncoding transcript Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17f A G 1: 20,779,375 V55A probably damaging Het
Inpp1 T A 1: 52,790,131 E243V probably benign Het
Leap2 A G 11: 53,422,807 L46P probably damaging Het
Map4k3 A T 17: 80,630,454 D339E probably benign Het
Met A G 6: 17,563,722 probably null Het
Mgam G T 6: 40,764,274 probably null Het
Mrgpra1 A G 7: 47,335,106 V275A possibly damaging Het
Mrgprx2 T A 7: 48,482,860 Q70L probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Mup18 G T 4: 61,671,891 F133L possibly damaging Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nin A T 12: 70,061,230 I196N probably damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Odc1 A G 12: 17,547,335 I13V probably benign Het
Olfr1024 T A 2: 85,904,755 I100F probably benign Het
Olfr1200 A T 2: 88,767,586 M243K possibly damaging Het
Olfr1377 T C 11: 50,985,232 F177S probably damaging Het
Pard3 A G 8: 127,359,776 I286V probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Prpf40b C T 15: 99,303,291 probably benign Het
Rnmt C T 18: 68,305,783 probably benign Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sirt2 A G 7: 28,772,212 probably null Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uqcrc2 T A 7: 120,641,714 V73E probably damaging Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zbtb4 C T 11: 69,776,358 T163I probably benign Het
Other mutations in Cyp2c68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Cyp2c68 APN 19 39712495 missense probably damaging 0.98
IGL00826:Cyp2c68 APN 19 39739505 missense possibly damaging 0.87
IGL01363:Cyp2c68 APN 19 39703427 missense probably benign 0.01
IGL01892:Cyp2c68 APN 19 39734344 missense probably benign 0.00
IGL02088:Cyp2c68 APN 19 39703521 splice site probably benign
IGL02422:Cyp2c68 APN 19 39734452 missense probably damaging 1.00
IGL03047:Cyp2c68 UTSW 19 39734460 missense probably benign 0.00
R0523:Cyp2c68 UTSW 19 39739429 missense probably benign 0.08
R0729:Cyp2c68 UTSW 19 39739550 splice site probably benign
R0975:Cyp2c68 UTSW 19 39703358 missense possibly damaging 0.85
R1117:Cyp2c68 UTSW 19 39712459 missense probably damaging 1.00
R1355:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1370:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1436:Cyp2c68 UTSW 19 39741040 start codon destroyed probably null 1.00
R1564:Cyp2c68 UTSW 19 39735580 nonsense probably null
R1730:Cyp2c68 UTSW 19 39699275 missense possibly damaging 0.87
R1865:Cyp2c68 UTSW 19 39734289 missense probably benign 0.04
R1905:Cyp2c68 UTSW 19 39735582 missense probably benign 0.01
R1951:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R1952:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R2230:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2231:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2866:Cyp2c68 UTSW 19 39689145 missense probably damaging 1.00
R3104:Cyp2c68 UTSW 19 39734313 missense probably benign
R4409:Cyp2c68 UTSW 19 39739452 missense probably damaging 0.98
R4575:Cyp2c68 UTSW 19 39734361 missense probably benign 0.21
R4620:Cyp2c68 UTSW 19 39712562 splice site probably null
R4684:Cyp2c68 UTSW 19 39699335 missense possibly damaging 0.48
R5023:Cyp2c68 UTSW 19 39712507 missense probably benign 0.01
R5410:Cyp2c68 UTSW 19 39699284 missense possibly damaging 0.65
R5513:Cyp2c68 UTSW 19 39703406 missense probably damaging 1.00
R5568:Cyp2c68 UTSW 19 39689082 missense probably benign 0.19
R5706:Cyp2c68 UTSW 19 39734318 missense possibly damaging 0.95
R5890:Cyp2c68 UTSW 19 39712492 missense probably damaging 1.00
R5897:Cyp2c68 UTSW 19 39712531 missense probably benign 0.01
R6007:Cyp2c68 UTSW 19 39734336 missense probably damaging 1.00
R6132:Cyp2c68 UTSW 19 39703414 missense possibly damaging 0.90
R6187:Cyp2c68 UTSW 19 39741008 missense probably benign 0.32
R6229:Cyp2c68 UTSW 19 39739178 missense probably benign 0.02
R6341:Cyp2c68 UTSW 19 39712489 missense possibly damaging 0.54
R7209:Cyp2c68 UTSW 19 39689205 missense probably damaging 1.00
R7330:Cyp2c68 UTSW 19 39689190 missense probably damaging 1.00
R7374:Cyp2c68 UTSW 19 39739204 critical splice acceptor site probably null
R7402:Cyp2c68 UTSW 19 39740874 missense probably benign 0.02
R7483:Cyp2c68 UTSW 19 39689137 missense probably benign 0.02
Z1088:Cyp2c68 UTSW 19 39739463 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTGAACTATTTTAGCATTTGCCC -3'
(R):5'- GTACCTTATCATGTTAACAAGGGC -3'

Sequencing Primer
(F):5'- GAACTATTTTAGCATTTGCCCCTTAG -3'
(R):5'- CATGTTAACAAGGGCAAATGTATGTG -3'
Posted On2014-10-15