Incidental Mutation 'R2224:Ar'
ID241589
Institutional Source Beutler Lab
Gene Symbol Ar
Ensembl Gene ENSMUSG00000046532
Gene Nameandrogen receptor
Synonyms
MMRRC Submission 040225-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2224 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location98148769-98323215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98151331 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 517 (M517K)
Ref Sequence ENSEMBL: ENSMUSP00000052648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052837]
PDB Structure
AR LBD with small molecule [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000052837
AA Change: M517K

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052648
Gene: ENSMUSG00000046532
AA Change: M517K

DomainStartEndE-ValueType
Pfam:Androgen_recep 6 442 5.4e-231 PFAM
ZnF_C4 536 607 3.34e-32 SMART
HOLI 686 850 1.04e-33 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear hormone receptor containing zinc finger and DNA-binding domains. The encoded protein is a key regulator of signalling by androgens, a class of steroid hormones involved in male reproductive development. The protein responds to hormone signalling by translocating to the nucleus, forming dimers, and binding to androgen response elements (AREs) in the promoters of target genes, which are subsequently transcriptionally activated. Activity of this protein is negatively regulated by nuclear receptor subfamily 0 group B member 1 (Nr0b1, also known as Dax1). Mutations in this gene result in feminized genitals and infertility in male animals. Loss of function in female animals also causes problems in reproductive development and function. [provided by RefSeq, May 2015]
PHENOTYPE: Hemizygous mutant males are androgen-resistant and therefore have small, undescended testes, and lack epididymal structures, vas deferens, and male accessory glands. They resemble females physically and behaviorally, but lack female reproductive organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,472,068 L1416R probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Ahnak G A 19: 9,012,991 probably benign Het
Arsb T A 13: 93,794,171 F216I probably damaging Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BC051142 C A 17: 34,448,763 probably null Het
Brinp3 C T 1: 146,901,920 Q702* probably null Het
Btbd9 C A 17: 30,527,346 A169S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep250 A C 2: 155,991,817 E1886D possibly damaging Het
Chd9 A C 8: 91,011,285 H1515P probably benign Het
Cyp2c68 A G 19: 39,735,582 C213R probably benign Het
Ddx41 G A 13: 55,531,401 T544I probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Eea1 T A 10: 96,020,012 V637D probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exo1 A G 1: 175,886,688 probably null Het
Fbxo21 T G 5: 118,008,123 Y597D probably damaging Het
Fbxw20 G C 9: 109,233,582 Q59E possibly damaging Het
Fpr3 T A 17: 17,971,193 V242D probably damaging Het
Fyb A G 15: 6,652,383 Y737C probably damaging Het
Gm17661 GG GGG 2: 90,917,708 noncoding transcript Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17f A G 1: 20,779,375 V55A probably damaging Het
Inpp1 T A 1: 52,790,131 E243V probably benign Het
Leap2 A G 11: 53,422,807 L46P probably damaging Het
Map4k3 A T 17: 80,630,454 D339E probably benign Het
Met A G 6: 17,563,722 probably null Het
Mgam G T 6: 40,764,274 probably null Het
Mrgpra1 A G 7: 47,335,106 V275A possibly damaging Het
Mrgprx2 T A 7: 48,482,860 Q70L probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Mup18 G T 4: 61,671,891 F133L possibly damaging Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nin A T 12: 70,061,230 I196N probably damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Odc1 A G 12: 17,547,335 I13V probably benign Het
Olfr1024 T A 2: 85,904,755 I100F probably benign Het
Olfr1200 A T 2: 88,767,586 M243K possibly damaging Het
Olfr1377 T C 11: 50,985,232 F177S probably damaging Het
Pard3 A G 8: 127,359,776 I286V probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Prpf40b C T 15: 99,303,291 probably benign Het
Rnmt C T 18: 68,305,783 probably benign Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sirt2 A G 7: 28,772,212 probably null Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uqcrc2 T A 7: 120,641,714 V73E probably damaging Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zbtb4 C T 11: 69,776,358 T163I probably benign Het
Other mutations in Ar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01515:Ar APN X 98251847 splice site probably benign
IGL02178:Ar APN X 98305438 missense probably damaging 1.00
IGL02626:Ar APN X 98314886 missense probably damaging 0.99
R0661:Ar UTSW X 98150565 missense probably damaging 1.00
R2226:Ar UTSW X 98151331 missense probably benign 0.19
R2227:Ar UTSW X 98151331 missense probably benign 0.19
Z1176:Ar UTSW X 98151009 missense not run
Predicted Primers PCR Primer
(F):5'- CAGCTGAAGAAGGCCAATTATATGG -3'
(R):5'- AAGATGACAGTCCCCACGAG -3'

Sequencing Primer
(F):5'- GCCAATTATATGGGCCAGGAG -3'
(R):5'- CACGAGGGCTCCAGATGTAG -3'
Posted On2014-10-15