Incidental Mutation 'R2223:Ptprn'
ID241592
Institutional Source Beutler Lab
Gene Symbol Ptprn
Ensembl Gene ENSMUSG00000026204
Gene Nameprotein tyrosine phosphatase, receptor type, N
SynonymsIA-2
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R2223 (G1)
Quality Score210
Status Validated
Chromosome1
Chromosomal Location75247027-75264502 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 75257937 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027404] [ENSMUST00000185849] [ENSMUST00000186178] [ENSMUST00000189769]
Predicted Effect probably benign
Transcript: ENSMUST00000027404
SMART Domains Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
RESP18 63 164 1.5e-51 SMART
low complexity region 174 201 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 360 368 N/A INTRINSIC
Pfam:Receptor_IA-2 471 559 7e-33 PFAM
transmembrane domain 579 601 N/A INTRINSIC
low complexity region 650 679 N/A INTRINSIC
PTPc 710 973 1.2e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185849
SMART Domains Protein: ENSMUSP00000140062
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 1 62 5e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186178
SMART Domains Protein: ENSMUSP00000139925
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 27 128 1.5e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188401
Predicted Effect probably benign
Transcript: ENSMUST00000189769
SMART Domains Protein: ENSMUSP00000140168
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 56 157 1.5e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191154
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene on a NOD background display insulitis and increased susceptibility to autoimmune diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Ptprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Ptprn APN 1 75252270 missense probably damaging 0.99
IGL01900:Ptprn APN 1 75252248 splice site probably benign
IGL02189:Ptprn APN 1 75258495 missense possibly damaging 0.73
IGL02282:Ptprn APN 1 75253156 missense probably damaging 1.00
IGL02452:Ptprn APN 1 75258169 missense probably benign 0.34
IGL02865:Ptprn APN 1 75262363 missense probably damaging 1.00
IGL02926:Ptprn APN 1 75247873 missense possibly damaging 0.95
IGL03062:Ptprn APN 1 75247873 missense possibly damaging 0.95
Delusion UTSW 1 75248166 missense probably damaging 1.00
H8562:Ptprn UTSW 1 75254620 missense possibly damaging 0.66
R0051:Ptprn UTSW 1 75252254 critical splice donor site probably null
R0107:Ptprn UTSW 1 75255712 missense probably damaging 0.99
R0801:Ptprn UTSW 1 75252265 missense probably damaging 1.00
R0865:Ptprn UTSW 1 75248138 splice site probably null
R1120:Ptprn UTSW 1 75258181 missense probably benign 0.00
R1534:Ptprn UTSW 1 75257943 critical splice donor site probably null
R1740:Ptprn UTSW 1 75262050 missense probably damaging 1.00
R1857:Ptprn UTSW 1 75247905 missense possibly damaging 0.64
R1927:Ptprn UTSW 1 75254122 missense probably benign 0.00
R1974:Ptprn UTSW 1 75254820 splice site probably null
R2071:Ptprn UTSW 1 75255144 missense probably damaging 1.00
R3714:Ptprn UTSW 1 75252767 splice site probably null
R4617:Ptprn UTSW 1 75252287 missense possibly damaging 0.74
R4832:Ptprn UTSW 1 75258265 missense probably benign 0.37
R5503:Ptprn UTSW 1 75251875 missense probably damaging 1.00
R5926:Ptprn UTSW 1 75254598 missense probably damaging 1.00
R6217:Ptprn UTSW 1 75248166 missense probably damaging 1.00
R6419:Ptprn UTSW 1 75264037 missense probably benign 0.10
R6793:Ptprn UTSW 1 75258142 missense probably benign 0.38
R6964:Ptprn UTSW 1 75260649 missense possibly damaging 0.83
R7071:Ptprn UTSW 1 75260619 missense possibly damaging 0.82
R7680:Ptprn UTSW 1 75247893 missense probably benign 0.16
R7777:Ptprn UTSW 1 75252302 missense possibly damaging 0.54
R7883:Ptprn UTSW 1 75262363 missense probably damaging 1.00
R8233:Ptprn UTSW 1 75253152 missense probably damaging 1.00
R8243:Ptprn UTSW 1 75252535 missense probably damaging 0.99
R8941:Ptprn UTSW 1 75251763 missense probably damaging 1.00
X0017:Ptprn UTSW 1 75253265 missense probably benign 0.15
Z1088:Ptprn UTSW 1 75260620 missense possibly damaging 0.70
Z1176:Ptprn UTSW 1 75251818 missense probably damaging 0.99
Z1177:Ptprn UTSW 1 75258037 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGGATCAGCTTGTCAATAGAC -3'
(R):5'- GATTCAGGGCTGCTCTACATG -3'

Sequencing Primer
(F):5'- TGATCCTCAGAACTCAGGAGTCTG -3'
(R):5'- TCTACATGGCCCAAGAGTTG -3'
Posted On2014-10-15