Incidental Mutation 'R2223:Fmo2'
ID241595
Institutional Source Beutler Lab
Gene Symbol Fmo2
Ensembl Gene ENSMUSG00000040170
Gene Nameflavin containing monooxygenase 2
Synonyms2310008D08Rik, 2310042I22Rik
MMRRC Submission 040224-MU
Accession Numbers

Genbank: NM_018881

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162874317-162898726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 162898244 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 21 (C21Y)
Ref Sequence ENSEMBL: ENSMUSP00000114226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045902] [ENSMUST00000111510] [ENSMUST00000143123]
Predicted Effect probably damaging
Transcript: ENSMUST00000045902
AA Change: C21Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044405
Gene: ENSMUSG00000040170
AA Change: C21Y

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 3 230 6.4e-12 PFAM
Pfam:Pyr_redox_3 6 220 4.4e-10 PFAM
Pfam:K_oxygenase 69 233 2.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111510
AA Change: C21Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107135
Gene: ENSMUSG00000040170
AA Change: C21Y

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 4 446 1.3e-6 PFAM
Pfam:Pyr_redox_3 6 220 8e-17 PFAM
Pfam:NAD_binding_8 7 72 4.3e-6 PFAM
Pfam:K_oxygenase 78 333 1.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143123
AA Change: C21Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114226
Gene: ENSMUSG00000040170
AA Change: C21Y

DomainStartEndE-ValueType
Pfam:FMO-like 2 161 1.2e-99 PFAM
Pfam:Pyr_redox_3 6 159 1.6e-8 PFAM
Pfam:NAD_binding_8 7 80 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156860
Meta Mutation Damage Score 0.8607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Fmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Fmo2 APN 1 162888713 nonsense probably null
IGL01299:Fmo2 APN 1 162878030 missense probably benign
IGL02617:Fmo2 APN 1 162876921 missense probably damaging 1.00
IGL02994:Fmo2 APN 1 162880620 missense probably damaging 1.00
IGL03270:Fmo2 APN 1 162882026 missense probably damaging 1.00
F5493:Fmo2 UTSW 1 162880532 missense probably benign 0.41
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0501:Fmo2 UTSW 1 162876928 missense probably benign 0.00
R0658:Fmo2 UTSW 1 162876774 missense possibly damaging 0.57
R0800:Fmo2 UTSW 1 162876814 missense probably benign 0.00
R4360:Fmo2 UTSW 1 162882014 missense probably damaging 0.99
R4523:Fmo2 UTSW 1 162887708 missense probably benign 0.44
R4755:Fmo2 UTSW 1 162888805 missense probably damaging 1.00
R6087:Fmo2 UTSW 1 162880433 missense probably benign 0.45
R6219:Fmo2 UTSW 1 162880516 missense probably damaging 0.97
R6668:Fmo2 UTSW 1 162877048 missense probably benign 0.15
R7042:Fmo2 UTSW 1 162880657 missense probably damaging 1.00
R7291:Fmo2 UTSW 1 162887702 missense probably benign 0.06
R7560:Fmo2 UTSW 1 162888749 missense probably damaging 1.00
R7580:Fmo2 UTSW 1 162877044 missense possibly damaging 0.46
R7657:Fmo2 UTSW 1 162888844 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATGCCAGCCTGAGTTC -3'
(R):5'- GTATTAAACTACCACCCATCCTGTG -3'

Sequencing Primer
(F):5'- GAGATGCCAGCCTGAGTTCATTTC -3'
(R):5'- CCATCCTGTGGTAAGTCAGTTAC -3'
Posted On2014-10-15