Incidental Mutation 'R2223:Col9a2'
ID241604
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Namecollagen, type IX, alpha 2
SynonymsCol9a-2
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121039385-121055322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 121054258 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 599 (R599G)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.3183 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
collision UTSW 4 121049716 critical splice donor site probably null
gravity_wave UTSW 4 121044019 critical splice donor site probably null
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
Z1176:Col9a2 UTSW 4 121053797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGGTACATAGTAAATGCCAG -3'
(R):5'- AATGCCAGGCTTCCACAAAG -3'

Sequencing Primer
(F):5'- GCCAGTTATGTATTGGACAATTTCC -3'
(R):5'- GAAAGCCCAGATGCCCATGG -3'
Posted On2014-10-15