Mutagenetix > Incidental Mutation

Incidental Mutation 'R2223:Col9a2'

241604

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

040224-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2223 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 121054258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 599 (R599G)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058754

SMART Domains

Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M48_N	41	225	2.5e-70	PFAM
Pfam:Peptidase_M48	228	473	5.5e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140119

Meta Mutation Damage Score

0.3183

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,247,457		probably null	Het
Abhd18	A	G	3: 40,934,861		probably benign	Het
Acvr1b	C	T	15: 101,203,043	A362V	probably benign	Het
Adamts5	A	C	16: 85,899,306	L321R	probably damaging	Het
Adamtsl1	A	C	4: 86,388,525	D1392A	probably benign	Het
Afdn	T	C	17: 13,883,737		probably benign	Het
Aph1b	A	T	9: 66,784,639	M121K	probably damaging	Het
Aspg	G	A	12: 112,114,434	A120T	probably damaging	Het
Atp8b1	T	A	18: 64,564,357	N472I	possibly damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cfd	A	T	10: 79,892,205		probably null	Het
Cntnap5b	A	G	1: 100,213,687	E242G	probably damaging	Het
Cradd	A	C	10: 95,175,873	V135G	probably benign	Het
Cry1	A	G	10: 85,143,753	C460R	probably damaging	Het
Cryz	A	T	3: 154,618,554	N192I	possibly damaging	Het
Cyp2d11	T	A	15: 82,390,131	M350L	probably benign	Het
Emsy	T	C	7: 98,590,775	E1091G	possibly damaging	Het
Exoc3l4	C	G	12: 111,426,152	A471G	possibly damaging	Het
Fam184a	G	A	10: 53,655,079	T733M	probably damaging	Het
Fmo2	C	T	1: 162,898,244	C21Y	probably damaging	Het
Glul	T	A	1: 153,906,497		probably null	Het
Gm5174	T	A	10: 86,656,508		noncoding transcript	Het
Gtpbp2	A	G	17: 46,167,227	I434V	probably benign	Het
Kctd10	G	T	5: 114,367,349	R195S	probably benign	Het
Lrrc38	T	A	4: 143,369,849	C243*	probably null	Het
Luc7l2	T	C	6: 38,565,724		probably benign	Het
Magi2	T	A	5: 20,465,672	V111D	probably damaging	Het
Map3k5	T	C	10: 20,067,920	V590A	possibly damaging	Het
Megf11	G	A	9: 64,660,431	G401S	possibly damaging	Het
Mgat4d	G	A	8: 83,355,672		probably benign	Het
Mroh1	T	C	15: 76,408,045		probably null	Het
Mx1	T	C	16: 97,455,232		probably benign	Het
Nlrp1b	A	G	11: 71,155,989		probably benign	Het
Ntrk3	T	C	7: 78,198,852	I759V	probably damaging	Het
Olfr800	T	A	10: 129,659,809	M1K	probably null	Het
Pde8b	T	C	13: 95,043,447	N318S	probably damaging	Het
Pkd1l1	T	C	11: 8,889,063	T874A	probably benign	Het
Pkd1l1	T	C	11: 8,950,422	T40A	probably benign	Het
Prdm2	T	C	4: 143,134,899	N607S	possibly damaging	Het
Ptprn	A	T	1: 75,257,937		probably benign	Het
Setx	T	G	2: 29,148,537	I1678S	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Snap91	T	C	9: 86,792,527	T544A	possibly damaging	Het
Sp8	G	A	12: 118,849,738	G443S	probably damaging	Het
Stk39	C	T	2: 68,314,579	G384S	probably damaging	Het
Sva	T	A	6: 42,038,423	M1K	probably null	Het
Trip10	A	G	17: 57,263,039	D568G	possibly damaging	Het
Trpa1	A	T	1: 14,903,256	F279L	probably null	Het
Ttc39b	T	C	4: 83,232,762	N532S	probably benign	Het
Ube2w	A	G	1: 16,597,959	S97P	possibly damaging	Het
Uvssa	C	T	5: 33,392,063	T356I	probably damaging	Het
Vmn1r25	A	C	6: 57,979,238	L22R	probably damaging	Het
Vmn2r112	T	G	17: 22,601,233	M29R	possibly damaging	Het
Vmn2r71	T	A	7: 85,624,093	M705K	probably benign	Het
Zfp516	C	A	18: 82,955,770	A31D	possibly damaging	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTGGTACATAGTAAATGCCAG -3'
(R):5'- AATGCCAGGCTTCCACAAAG -3'

Sequencing Primer
(F):5'- GCCAGTTATGTATTGGACAATTTCC -3'
(R):5'- GAAAGCCCAGATGCCCATGG -3'

Posted On

2014-10-15