Incidental Mutation 'R2223:Mgat4d'
ID241617
Institutional Source Beutler Lab
Gene Symbol Mgat4d
Ensembl Gene ENSMUSG00000035057
Gene NameMGAT4 family, member C
Synonyms4933434I20Rik
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83348471-83382320 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 83355672 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038692]
Predicted Effect probably benign
Transcript: ENSMUST00000038692
SMART Domains Protein: ENSMUSP00000041629
Gene: ENSMUSG00000035057

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_54 70 373 5.9e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139692
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Mgat4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Mgat4d APN 8 83354796 missense probably benign 0.21
IGL01634:Mgat4d APN 8 83368116 missense possibly damaging 0.71
IGL01987:Mgat4d APN 8 83368102 missense probably damaging 1.00
IGL02084:Mgat4d APN 8 83368981 missense possibly damaging 0.72
R0546:Mgat4d UTSW 8 83355721 missense possibly damaging 0.94
R1322:Mgat4d UTSW 8 83365725 missense possibly damaging 0.74
R1526:Mgat4d UTSW 8 83369037 missense probably benign 0.25
R1617:Mgat4d UTSW 8 83365711 missense probably damaging 1.00
R3157:Mgat4d UTSW 8 83354821 missense probably benign
R3421:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R3422:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R4387:Mgat4d UTSW 8 83371706 missense probably damaging 1.00
R4796:Mgat4d UTSW 8 83358120 missense probably damaging 1.00
R4805:Mgat4d UTSW 8 83358158 splice site probably null
R5054:Mgat4d UTSW 8 83368208 splice site probably null
R6366:Mgat4d UTSW 8 83368951 splice site probably null
R6927:Mgat4d UTSW 8 83354867 missense probably benign 0.03
R7053:Mgat4d UTSW 8 83371632 missense probably damaging 0.98
R7554:Mgat4d UTSW 8 83355773 missense probably benign 0.00
R7566:Mgat4d UTSW 8 83358023 missense probably damaging 1.00
R8111:Mgat4d UTSW 8 83368147 missense probably damaging 0.96
Z1176:Mgat4d UTSW 8 83348521 missense probably benign 0.04
Z1176:Mgat4d UTSW 8 83368112 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CATTTCCTTGAACAGTAGGTCTATGG -3'
(R):5'- ACTTGAAGTCAGTTTTGCAGTTCTG -3'

Sequencing Primer
(F):5'- GAGAGCCAGAGTTCTGTTTCCAAC -3'
(R):5'- GCAGTTCTGATTGTGCTTACCGC -3'
Posted On2014-10-15