Incidental Mutation 'R2223:Snap91'
ID241620
Institutional Source Beutler Lab
Gene Symbol Snap91
Ensembl Gene ENSMUSG00000033419
Gene Namesynaptosomal-associated protein 91
SynonymsF1-20, AP180, 91kDa
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86765923-86880654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86792527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 544 (T544A)
Ref Sequence ENSEMBL: ENSMUSP00000074066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036347] [ENSMUST00000074468] [ENSMUST00000074501] [ENSMUST00000098495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036347
AA Change: T544A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046189
Gene: ENSMUSG00000033419
AA Change: T544A

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 3.27e-5 PROSPERO
internal_repeat_1 584 611 3.27e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 728 757 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000074468
AA Change: T544A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074066
Gene: ENSMUSG00000033419
AA Change: T544A

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 6.86e-5 PROSPERO
internal_repeat_1 584 611 6.86e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
low complexity region 733 762 N/A INTRINSIC
low complexity region 833 847 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074501
SMART Domains Protein: ENSMUSP00000074095
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 440 469 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098495
AA Change: T537A
SMART Domains Protein: ENSMUSP00000096096
Gene: ENSMUSG00000033419
AA Change: T537A

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 396 426 N/A INTRINSIC
low complexity region 432 459 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
low complexity region 492 551 N/A INTRINSIC
internal_repeat_1 552 579 4.67e-5 PROSPERO
internal_repeat_1 577 604 4.67e-5 PROSPERO
low complexity region 609 627 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 698 727 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190388
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display postnatal growth retardation, limb clasping, altered behavior, defects in synaptic vesicle reformation, impaired neurotransmission, excitatory/inhibitory imbalance, epileptic seizures, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Snap91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Snap91 APN 9 86821737 missense probably benign 0.01
IGL01147:Snap91 APN 9 86798558 missense probably benign 0.37
IGL01358:Snap91 APN 9 86806560 missense probably damaging 1.00
IGL01501:Snap91 APN 9 86838125 missense probably damaging 0.99
IGL01883:Snap91 APN 9 86775612 missense probably damaging 1.00
IGL02632:Snap91 APN 9 86839522 missense possibly damaging 0.94
IGL02864:Snap91 APN 9 86838088 missense possibly damaging 0.95
IGL03276:Snap91 APN 9 86825012 missense possibly damaging 0.78
PIT4514001:Snap91 UTSW 9 86879433 missense possibly damaging 0.86
R1564:Snap91 UTSW 9 86792196 missense possibly damaging 0.85
R1804:Snap91 UTSW 9 86783417 missense probably benign 0.01
R1840:Snap91 UTSW 9 86815465 missense probably damaging 1.00
R1869:Snap91 UTSW 9 86790141 critical splice acceptor site probably null
R2156:Snap91 UTSW 9 86825077 missense probably damaging 1.00
R2221:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2233:Snap91 UTSW 9 86798571 missense probably benign 0.23
R2680:Snap91 UTSW 9 86879550 start codon destroyed probably null 1.00
R3077:Snap91 UTSW 9 86838854 missense possibly damaging 0.95
R3702:Snap91 UTSW 9 86806520 missense probably damaging 0.99
R3840:Snap91 UTSW 9 86839565 missense probably damaging 1.00
R3912:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3913:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3958:Snap91 UTSW 9 86838130 missense probably damaging 1.00
R3963:Snap91 UTSW 9 86775612 missense probably damaging 1.00
R4043:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4133:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4641:Snap91 UTSW 9 86879475 missense probably damaging 1.00
R4674:Snap91 UTSW 9 86792017 missense possibly damaging 0.73
R4770:Snap91 UTSW 9 86773601 missense possibly damaging 0.86
R4798:Snap91 UTSW 9 86783454 intron probably benign
R4849:Snap91 UTSW 9 86792560 missense possibly damaging 0.53
R4991:Snap91 UTSW 9 86790154 splice site probably null
R5200:Snap91 UTSW 9 86815444 missense probably damaging 1.00
R5354:Snap91 UTSW 9 86835124 missense possibly damaging 0.84
R5644:Snap91 UTSW 9 86790153 splice site probably null
R6029:Snap91 UTSW 9 86825080 splice site probably null
R6091:Snap91 UTSW 9 86839628 missense probably damaging 1.00
R6175:Snap91 UTSW 9 86825000 missense probably damaging 1.00
R6191:Snap91 UTSW 9 86838052 missense probably damaging 1.00
R6611:Snap91 UTSW 9 86790127 missense probably benign 0.33
R6764:Snap91 UTSW 9 86792181 missense probably benign 0.33
R6881:Snap91 UTSW 9 86773593 missense possibly damaging 0.73
R7201:Snap91 UTSW 9 86790146 splice site probably null
R7223:Snap91 UTSW 9 86879557 start gained probably benign
R7247:Snap91 UTSW 9 86792616 missense unknown
R7327:Snap91 UTSW 9 86773545 missense unknown
R7520:Snap91 UTSW 9 86839649 missense probably damaging 1.00
R7572:Snap91 UTSW 9 86806494 missense possibly damaging 0.58
R7616:Snap91 UTSW 9 86839621 missense probably damaging 1.00
R7690:Snap91 UTSW 9 86824978 missense possibly damaging 0.95
R7750:Snap91 UTSW 9 86798709 splice site probably null
R8747:Snap91 UTSW 9 86804524 missense probably damaging 0.99
X0027:Snap91 UTSW 9 86798828 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTCTGGGTTAAGTAGCAAATGG -3'
(R):5'- CCTTTTGCCCCATCTGAAGG -3'

Sequencing Primer
(F):5'- TAGCAAATGGACTCTAGAGAACC -3'
(R):5'- TTTGCCCCATCTGAAGGTAGCG -3'
Posted On2014-10-15