Incidental Mutation 'R2223:Gm5174'
ID 241625
Institutional Source Beutler Lab
Gene Symbol Gm5174
Ensembl Gene ENSMUSG00000090308
Gene Name predicted gene 5174
Synonyms
MMRRC Submission 040224-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R2223 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86491822-86493244 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 86492372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171131
SMART Domains Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

DomainStartEndE-ValueType
S_TKc 14 262 5.59e-86 SMART
UBA 276 313 1.28e-3 SMART
low complexity region 447 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219608
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A G 3: 40,889,296 (GRCm39) probably benign Het
Acvr1b C T 15: 101,100,924 (GRCm39) A362V probably benign Het
Adamts5 A C 16: 85,696,194 (GRCm39) L321R probably damaging Het
Adamtsl1 A C 4: 86,306,762 (GRCm39) D1392A probably benign Het
Afdn T C 17: 14,103,999 (GRCm39) probably benign Het
Aph1b A T 9: 66,691,921 (GRCm39) M121K probably damaging Het
Aspg G A 12: 112,080,868 (GRCm39) A120T probably damaging Het
Atp8b1 T A 18: 64,697,428 (GRCm39) N472I possibly damaging Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Cdcp3 A T 7: 130,849,186 (GRCm39) probably null Het
Cfd A T 10: 79,728,039 (GRCm39) probably null Het
Cntnap5b A G 1: 100,141,412 (GRCm39) E242G probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Cradd A C 10: 95,011,735 (GRCm39) V135G probably benign Het
Cry1 A G 10: 84,979,617 (GRCm39) C460R probably damaging Het
Cryz A T 3: 154,324,191 (GRCm39) N192I possibly damaging Het
Cyp2d11 T A 15: 82,274,332 (GRCm39) M350L probably benign Het
Emsy T C 7: 98,239,982 (GRCm39) E1091G possibly damaging Het
Exoc3l4 C G 12: 111,392,586 (GRCm39) A471G possibly damaging Het
Fam184a G A 10: 53,531,175 (GRCm39) T733M probably damaging Het
Fmo2 C T 1: 162,725,813 (GRCm39) C21Y probably damaging Het
Glul T A 1: 153,782,243 (GRCm39) probably null Het
Gtpbp2 A G 17: 46,478,153 (GRCm39) I434V probably benign Het
Kctd10 G T 5: 114,505,410 (GRCm39) R195S probably benign Het
Lrrc38 T A 4: 143,096,419 (GRCm39) C243* probably null Het
Luc7l2 T C 6: 38,542,659 (GRCm39) probably benign Het
Magi2 T A 5: 20,670,670 (GRCm39) V111D probably damaging Het
Map3k5 T C 10: 19,943,666 (GRCm39) V590A possibly damaging Het
Megf11 G A 9: 64,567,713 (GRCm39) G401S possibly damaging Het
Mgat4d G A 8: 84,082,301 (GRCm39) probably benign Het
Mroh1 T C 15: 76,292,245 (GRCm39) probably null Het
Mx1 T C 16: 97,256,432 (GRCm39) probably benign Het
Nlrp1b A G 11: 71,046,815 (GRCm39) probably benign Het
Ntrk3 T C 7: 77,848,600 (GRCm39) I759V probably damaging Het
Or6c210 T A 10: 129,495,678 (GRCm39) M1K probably null Het
Pde8b T C 13: 95,179,955 (GRCm39) N318S probably damaging Het
Pkd1l1 T C 11: 8,839,063 (GRCm39) T874A probably benign Het
Pkd1l1 T C 11: 8,900,422 (GRCm39) T40A probably benign Het
Prdm2 T C 4: 142,861,469 (GRCm39) N607S possibly damaging Het
Ptprn A T 1: 75,234,581 (GRCm39) probably benign Het
Setx T G 2: 29,038,549 (GRCm39) I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Snap91 T C 9: 86,674,580 (GRCm39) T544A possibly damaging Het
Sp8 G A 12: 118,813,473 (GRCm39) G443S probably damaging Het
Stk39 C T 2: 68,144,923 (GRCm39) G384S probably damaging Het
Sva T A 6: 42,015,357 (GRCm39) M1K probably null Het
Trip10 A G 17: 57,570,039 (GRCm39) D568G possibly damaging Het
Trpa1 A T 1: 14,973,480 (GRCm39) F279L probably null Het
Ttc39b T C 4: 83,150,999 (GRCm39) N532S probably benign Het
Ube2w A G 1: 16,668,183 (GRCm39) S97P possibly damaging Het
Uvssa C T 5: 33,549,407 (GRCm39) T356I probably damaging Het
Vmn1r25 A C 6: 57,956,223 (GRCm39) L22R probably damaging Het
Vmn2r112 T G 17: 22,820,214 (GRCm39) M29R possibly damaging Het
Vmn2r71 T A 7: 85,273,301 (GRCm39) M705K probably benign Het
Zfp516 C A 18: 82,973,895 (GRCm39) A31D possibly damaging Het
Other mutations in Gm5174
AlleleSourceChrCoordTypePredicted EffectPPH Score
Laco UTSW 10 86,491,972 (GRCm39) unclassified noncoding transcript
R1083:Gm5174 UTSW 10 86,491,972 (GRCm39) unclassified noncoding transcript
R1199:Gm5174 UTSW 10 86,493,189 (GRCm39) unclassified noncoding transcript
R1296:Gm5174 UTSW 10 86,492,866 (GRCm39) unclassified noncoding transcript
R1715:Gm5174 UTSW 10 86,492,776 (GRCm39) unclassified noncoding transcript
R1957:Gm5174 UTSW 10 86,492,617 (GRCm39) unclassified noncoding transcript
R2221:Gm5174 UTSW 10 86,492,372 (GRCm39) unclassified noncoding transcript
R3104:Gm5174 UTSW 10 86,492,519 (GRCm39) unclassified noncoding transcript
R4165:Gm5174 UTSW 10 86,492,797 (GRCm39) unclassified noncoding transcript
R4166:Gm5174 UTSW 10 86,492,797 (GRCm39) unclassified noncoding transcript
R4243:Gm5174 UTSW 10 86,492,144 (GRCm39) unclassified noncoding transcript
R4244:Gm5174 UTSW 10 86,492,144 (GRCm39) unclassified noncoding transcript
R5024:Gm5174 UTSW 10 86,492,451 (GRCm39) unclassified noncoding transcript
R5292:Gm5174 UTSW 10 86,492,562 (GRCm39) unclassified noncoding transcript
R5586:Gm5174 UTSW 10 86,492,409 (GRCm39) unclassified noncoding transcript
R5864:Gm5174 UTSW 10 86,493,045 (GRCm39) unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATTGTCCATCGAGACATTAAACCAC -3'
(R):5'- CGTGACCCAAGGATGTTTCTC -3'

Sequencing Primer
(F):5'- ACAGAATGTGCTCCTCGATG -3'
(R):5'- CAATGTCTTCAATGGATGGCC -3'
Posted On 2014-10-15