Incidental Mutation 'R2223:Pkd1l1'
ID241629
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8950422 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000136518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect unknown
Transcript: ENSMUST00000154153
AA Change: T490A
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: T490A

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178195
AA Change: T40A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: T40A

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
R7699:Pkd1l1 UTSW 11 8965142 missense
R7922:Pkd1l1 UTSW 11 8849013 missense
R7922:Pkd1l1 UTSW 11 8909857 missense
R7980:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R7993:Pkd1l1 UTSW 11 8945262 missense
R8052:Pkd1l1 UTSW 11 8947315 missense
R8125:Pkd1l1 UTSW 11 8947241 missense probably damaging 1.00
R8420:Pkd1l1 UTSW 11 8870277 nonsense probably null
R8675:Pkd1l1 UTSW 11 8848916 critical splice donor site probably null
R8683:Pkd1l1 UTSW 11 8871805 missense
R8709:Pkd1l1 UTSW 11 8855567 missense
R8711:Pkd1l1 UTSW 11 8865550 missense
R8725:Pkd1l1 UTSW 11 8961482 missense
R8733:Pkd1l1 UTSW 11 8933657 missense
R8822:Pkd1l1 UTSW 11 8856312 missense
R8871:Pkd1l1 UTSW 11 8950503 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- TGTCTCAACCTACTTTGGCAG -3'
(R):5'- TGACTGCTGTAAGTGAGCATTG -3'

Sequencing Primer
(F):5'- TACTTTGGCAGAATTCCCAGAC -3'
(R):5'- TGCTCTCTCAGGTTCAGA -3'
Posted On2014-10-15