Incidental Mutation 'R2223:Nlrp1b'
ID241630
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 71155989 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108514] [ENSMUST00000108515] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably benign
Transcript: ENSMUST00000094046
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108514
SMART Domains Protein: ENSMUSP00000104154
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.1e-40 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 814 1068 2.4e-136 PFAM
Pfam:CARD 1086 1169 3.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108515
SMART Domains Protein: ENSMUSP00000104155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.9e-41 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 815 1067 5e-104 PFAM
Pfam:CARD 1086 1169 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R7994:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71216921 missense probably benign 0.15
Z1176:Nlrp1b UTSW 11 71182270 missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71181299 nonsense probably null
Z1177:Nlrp1b UTSW 11 71217224 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGTGATTTCTGAGATGCTCAC -3'
(R):5'- TTGGACAAGCTGCATGGTC -3'

Sequencing Primer
(F):5'- GATGCTCACCTACCATCAGGATCTG -3'
(R):5'- TCTGGTGCTGAATGAAGAATCC -3'
Posted On2014-10-15