Incidental Mutation 'R2251:Zfp575'
ID241667
Institutional Source Beutler Lab
Gene Symbol Zfp575
Ensembl Gene ENSMUSG00000066721
Gene Namezinc finger protein 575
Synonyms
MMRRC Submission 040251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2251 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24583838-24587641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24585590 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 209 (C209S)
Ref Sequence ENSEMBL: ENSMUSP00000092294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077191] [ENSMUST00000094705]
Predicted Effect probably benign
Transcript: ENSMUST00000077191
SMART Domains Protein: ENSMUSP00000076433
Gene: ENSMUSG00000064254

DomainStartEndE-ValueType
Lactamase_B 34 195 1.05e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094705
AA Change: C209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092294
Gene: ENSMUSG00000066721
AA Change: C209S

DomainStartEndE-ValueType
ZnF_C2H2 57 79 3.58e-2 SMART
ZnF_C2H2 85 107 4.11e-2 SMART
ZnF_C2H2 113 135 1.14e0 SMART
ZnF_C2H2 141 163 2.71e-2 SMART
ZnF_C2H2 171 193 1.08e-1 SMART
ZnF_C2H2 207 229 8.81e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Abl1 T A 2: 31,779,119 V170E probably damaging Het
Akap13 C T 7: 75,739,477 T2381M possibly damaging Het
Armc8 T A 9: 99,502,600 probably null Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cntn2 T C 1: 132,525,321 E411G probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Fam186a T C 15: 99,945,097 T1089A probably benign Het
Fgb T G 3: 83,043,284 T388P probably damaging Het
Fndc1 G A 17: 7,753,607 R1498W probably damaging Het
Gch1 T C 14: 47,189,341 probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
H2-M10.1 A C 17: 36,325,606 L102R probably damaging Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
N4bp2 G A 5: 65,806,728 V707I probably damaging Het
Nav2 A G 7: 49,453,277 K608E probably damaging Het
Nfix T C 8: 84,716,170 D458G probably benign Het
Ngdn T C 14: 55,023,395 probably null Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr138 C T 17: 38,274,903 A44V probably benign Het
Olfr672 A T 7: 104,996,595 M103K probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pbld2 G T 10: 63,024,605 probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Pwp2 T A 10: 78,181,088 Q266L probably benign Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Scn8a A G 15: 101,017,106 I1184V probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Smim11 T C 16: 92,310,828 Y14H probably benign Het
Spata17 A T 1: 187,048,473 L359Q possibly damaging Het
Spn T C 7: 127,137,159 K59E probably benign Het
Tap2 A G 17: 34,211,954 S343G probably damaging Het
Tcp11l2 T C 10: 84,605,069 probably null Het
Tlr11 T A 14: 50,360,792 N78K probably benign Het
Tm9sf2 T A 14: 122,139,731 S224T probably benign Het
Trpm1 G A 7: 64,209,976 G261D probably damaging Het
Usp3 T C 9: 66,562,578 D87G probably damaging Het
Vmn1r189 T C 13: 22,102,548 K40E probably damaging Het
Vps45 A T 3: 96,057,040 D56E probably benign Het
Vstm2a C A 11: 16,368,273 Q231K probably benign Het
Zcchc11 T A 4: 108,520,208 D938E probably damaging Het
Zfp768 T C 7: 127,344,378 T193A probably benign Het
Zfp867 T A 11: 59,465,493 R38* probably null Het
Other mutations in Zfp575
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Zfp575 APN 7 24585757 missense probably damaging 1.00
IGL01942:Zfp575 APN 7 24585815 missense possibly damaging 0.58
IGL03136:Zfp575 APN 7 24585956 missense probably damaging 1.00
R0051:Zfp575 UTSW 7 24586087 missense probably benign
R0834:Zfp575 UTSW 7 24585820 missense probably damaging 1.00
R4036:Zfp575 UTSW 7 24586015 missense possibly damaging 0.94
R5416:Zfp575 UTSW 7 24586722 missense probably benign
R5625:Zfp575 UTSW 7 24585652 missense possibly damaging 0.61
R5782:Zfp575 UTSW 7 24585602 missense possibly damaging 0.64
R7599:Zfp575 UTSW 7 24586668 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GGGCTACCTGTATCAAGACC -3'
(R):5'- GATTGCCCCAAGTCCTTCTG -3'

Sequencing Primer
(F):5'- CCTGTTAGAGGGAAGTCCACAC -3'
(R):5'- TGCTACCCGTCCAAGTTGG -3'
Posted On2014-10-16