Incidental Mutation 'R2251:Pbld2'
ID241686
Institutional Source Beutler Lab
Gene Symbol Pbld2
Ensembl Gene ENSMUSG00000020072
Gene Namephenazine biosynthesis-like protein domain containing 2
Synonyms3110049J23Rik
MMRRC Submission 040251-MU
Accession Numbers

Genbank: NM_026085 ; MGI: 1914557

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2251 (G1)
Quality Score128
Status Not validated
Chromosome10
Chromosomal Location63024315-63058813 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 63024605 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020262] [ENSMUST00000020263] [ENSMUST00000118898] [ENSMUST00000119814] [ENSMUST00000124784] [ENSMUST00000140743]
Predicted Effect probably benign
Transcript: ENSMUST00000020262
SMART Domains Protein: ENSMUSP00000020262
Gene: ENSMUSG00000020072

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 284 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020263
SMART Domains Protein: ENSMUSP00000020263
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 191 N/A INTRINSIC
RRM 196 266 7.96e-9 SMART
low complexity region 272 286 N/A INTRINSIC
low complexity region 294 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118898
SMART Domains Protein: ENSMUSP00000112424
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 176 N/A INTRINSIC
RRM 181 251 7.96e-9 SMART
low complexity region 257 271 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119814
SMART Domains Protein: ENSMUSP00000113134
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124784
SMART Domains Protein: ENSMUSP00000121682
Gene: ENSMUSG00000020072

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 69 175 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140743
SMART Domains Protein: ENSMUSP00000118444
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Abl1 T A 2: 31,779,119 V170E probably damaging Het
Akap13 C T 7: 75,739,477 T2381M possibly damaging Het
Armc8 T A 9: 99,502,600 probably null Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cntn2 T C 1: 132,525,321 E411G probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Fam186a T C 15: 99,945,097 T1089A probably benign Het
Fgb T G 3: 83,043,284 T388P probably damaging Het
Fndc1 G A 17: 7,753,607 R1498W probably damaging Het
Gch1 T C 14: 47,189,341 probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
H2-M10.1 A C 17: 36,325,606 L102R probably damaging Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
N4bp2 G A 5: 65,806,728 V707I probably damaging Het
Nav2 A G 7: 49,453,277 K608E probably damaging Het
Nfix T C 8: 84,716,170 D458G probably benign Het
Ngdn T C 14: 55,023,395 probably null Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr138 C T 17: 38,274,903 A44V probably benign Het
Olfr672 A T 7: 104,996,595 M103K probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Pwp2 T A 10: 78,181,088 Q266L probably benign Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Scn8a A G 15: 101,017,106 I1184V probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Smim11 T C 16: 92,310,828 Y14H probably benign Het
Spata17 A T 1: 187,048,473 L359Q possibly damaging Het
Spn T C 7: 127,137,159 K59E probably benign Het
Tap2 A G 17: 34,211,954 S343G probably damaging Het
Tcp11l2 T C 10: 84,605,069 probably null Het
Tlr11 T A 14: 50,360,792 N78K probably benign Het
Tm9sf2 T A 14: 122,139,731 S224T probably benign Het
Trpm1 G A 7: 64,209,976 G261D probably damaging Het
Usp3 T C 9: 66,562,578 D87G probably damaging Het
Vmn1r189 T C 13: 22,102,548 K40E probably damaging Het
Vps45 A T 3: 96,057,040 D56E probably benign Het
Vstm2a C A 11: 16,368,273 Q231K probably benign Het
Zcchc11 T A 4: 108,520,208 D938E probably damaging Het
Zfp575 A T 7: 24,585,590 C209S probably damaging Het
Zfp768 T C 7: 127,344,378 T193A probably benign Het
Zfp867 T A 11: 59,465,493 R38* probably null Het
Other mutations in Pbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pbld2 APN 10 63071955 missense probably benign 0.01
IGL02162:Pbld2 APN 10 63071400 splice site probably benign
IGL03206:Pbld2 APN 10 63047482 missense probably benign 0.06
R0311:Pbld2 UTSW 10 63054507 critical splice donor site probably null
R0366:Pbld2 UTSW 10 63053957 unclassified probably benign
R0727:Pbld2 UTSW 10 63067519 missense probably benign 0.03
R0731:Pbld2 UTSW 10 63056811 missense probably damaging 1.00
R1412:Pbld2 UTSW 10 63047522 missense probably damaging 1.00
R1523:Pbld2 UTSW 10 63076433 missense probably benign 0.01
R1531:Pbld2 UTSW 10 63053953 critical splice donor site probably null
R1773:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1778:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1797:Pbld2 UTSW 10 63075124 critical splice donor site probably null
R3036:Pbld2 UTSW 10 63071446 missense probably damaging 1.00
R3117:Pbld2 UTSW 10 63054436 missense probably benign 0.00
R3622:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3624:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3734:Pbld2 UTSW 10 63071465 missense probably damaging 1.00
R4260:Pbld2 UTSW 10 63024407 unclassified probably benign
R4684:Pbld2 UTSW 10 63057697 missense probably damaging 1.00
R4928:Pbld2 UTSW 10 63047999 missense probably damaging 1.00
R4936:Pbld2 UTSW 10 63052238 missense probably damaging 1.00
R5508:Pbld2 UTSW 10 63066665 unclassified probably null
R5596:Pbld2 UTSW 10 63072012 missense probably damaging 1.00
R5603:Pbld2 UTSW 10 63071449 missense probably benign
R6298:Pbld2 UTSW 10 63039152 missense probably benign 0.05
R6404:Pbld2 UTSW 10 63054328 missense probably damaging 0.98
R7089:Pbld2 UTSW 10 63053912 missense probably benign 0.23
R7134:Pbld2 UTSW 10 63024589 unclassified probably benign
R7423:Pbld2 UTSW 10 63048004 missense probably damaging 1.00
YA93:Pbld2 UTSW 10 63054445 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAAACCCAGCAGGATTCCCG -3'
(R):5'- ACGTTCACAGCCTTAGTCTG -3'

Sequencing Primer
(F):5'- AGCAGGATTCCCGTCCTAG -3'
(R):5'- ACAGCCTTAGTCTGTCCAGC -3'
Posted On2014-10-16