Incidental Mutation 'R2251:Tcp11l2'
ID 241688
Institutional Source Beutler Lab
Gene Symbol Tcp11l2
Ensembl Gene ENSMUSG00000020034
Gene Name t-complex 11 (mouse) like 2
Synonyms E430026E19Rik
MMRRC Submission 040251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R2251 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 84576626-84614359 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 84605069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020223] [ENSMUST00000020223]
AlphaFold Q8K1H7
Predicted Effect probably null
Transcript: ENSMUST00000020223
SMART Domains Protein: ENSMUSP00000020223
Gene: ENSMUSG00000020034

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:Tcp11 77 497 5.8e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020223
SMART Domains Protein: ENSMUSP00000020223
Gene: ENSMUSG00000020034

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:Tcp11 77 497 5.8e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160057
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Abl1 T A 2: 31,779,119 V170E probably damaging Het
Akap13 C T 7: 75,739,477 T2381M possibly damaging Het
Armc8 T A 9: 99,502,600 probably null Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cntn2 T C 1: 132,525,321 E411G probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Fam186a T C 15: 99,945,097 T1089A probably benign Het
Fgb T G 3: 83,043,284 T388P probably damaging Het
Fndc1 G A 17: 7,753,607 R1498W probably damaging Het
Gch1 T C 14: 47,189,341 probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
H2-M10.1 A C 17: 36,325,606 L102R probably damaging Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
N4bp2 G A 5: 65,806,728 V707I probably damaging Het
Nav2 A G 7: 49,453,277 K608E probably damaging Het
Nfix T C 8: 84,716,170 D458G probably benign Het
Ngdn T C 14: 55,023,395 probably null Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr138 C T 17: 38,274,903 A44V probably benign Het
Olfr672 A T 7: 104,996,595 M103K probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pbld2 G T 10: 63,024,605 probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Pwp2 T A 10: 78,181,088 Q266L probably benign Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Scn8a A G 15: 101,017,106 I1184V probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Smim11 T C 16: 92,310,828 Y14H probably benign Het
Spata17 A T 1: 187,048,473 L359Q possibly damaging Het
Spn T C 7: 127,137,159 K59E probably benign Het
Tap2 A G 17: 34,211,954 S343G probably damaging Het
Tlr11 T A 14: 50,360,792 N78K probably benign Het
Tm9sf2 T A 14: 122,139,731 S224T probably benign Het
Trpm1 G A 7: 64,209,976 G261D probably damaging Het
Usp3 T C 9: 66,562,578 D87G probably damaging Het
Vmn1r189 T C 13: 22,102,548 K40E probably damaging Het
Vps45 A T 3: 96,057,040 D56E probably benign Het
Vstm2a C A 11: 16,368,273 Q231K probably benign Het
Zcchc11 T A 4: 108,520,208 D938E probably damaging Het
Zfp575 A T 7: 24,585,590 C209S probably damaging Het
Zfp768 T C 7: 127,344,378 T193A probably benign Het
Zfp867 T A 11: 59,465,493 R38* probably null Het
Other mutations in Tcp11l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Tcp11l2 APN 10 84594710 missense possibly damaging 0.82
IGL00845:Tcp11l2 APN 10 84604983 missense possibly damaging 0.95
IGL02375:Tcp11l2 APN 10 84605068 critical splice donor site probably null
IGL02418:Tcp11l2 APN 10 84613606 nonsense probably null
IGL03325:Tcp11l2 APN 10 84604900 missense possibly damaging 0.76
R0031:Tcp11l2 UTSW 10 84591140 missense probably damaging 0.98
R0591:Tcp11l2 UTSW 10 84604594 missense probably benign 0.05
R1563:Tcp11l2 UTSW 10 84584944 missense probably damaging 0.96
R1607:Tcp11l2 UTSW 10 84613487 missense probably damaging 1.00
R1840:Tcp11l2 UTSW 10 84604599 missense probably damaging 0.98
R2144:Tcp11l2 UTSW 10 84613499 missense probably damaging 1.00
R4289:Tcp11l2 UTSW 10 84605073 splice site probably null
R4639:Tcp11l2 UTSW 10 84584936 missense probably damaging 1.00
R4844:Tcp11l2 UTSW 10 84613691 missense probably benign 0.00
R4973:Tcp11l2 UTSW 10 84591163 missense probably damaging 0.98
R5264:Tcp11l2 UTSW 10 84613660 missense probably damaging 1.00
R5970:Tcp11l2 UTSW 10 84594797 splice site probably benign
R6966:Tcp11l2 UTSW 10 84591269 missense possibly damaging 0.79
R7250:Tcp11l2 UTSW 10 84587241 critical splice donor site probably null
R7535:Tcp11l2 UTSW 10 84594659 missense possibly damaging 0.67
R7565:Tcp11l2 UTSW 10 84587134 missense probably damaging 1.00
R7619:Tcp11l2 UTSW 10 84594758 missense probably damaging 1.00
R7774:Tcp11l2 UTSW 10 84604983 missense possibly damaging 0.95
R8145:Tcp11l2 UTSW 10 84608616 missense probably damaging 1.00
R8379:Tcp11l2 UTSW 10 84613605 missense probably damaging 1.00
R8458:Tcp11l2 UTSW 10 84613532 nonsense probably null
R8821:Tcp11l2 UTSW 10 84613658 missense probably damaging 1.00
R8831:Tcp11l2 UTSW 10 84613658 missense probably damaging 1.00
RF008:Tcp11l2 UTSW 10 84613524 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCATGGCACTGGGCTTC -3'
(R):5'- ACTTCCAACAAGCTGCAGG -3'

Sequencing Primer
(F):5'- TGCTAGACACTCATGACAGATG -3'
(R):5'- TGCAGGACACTGTAGAAAGAG -3'
Posted On 2014-10-16