Incidental Mutation 'R2251:Vmn1r189'
ID241693
Institutional Source Beutler Lab
Gene Symbol Vmn1r189
Ensembl Gene ENSMUSG00000099611
Gene Namevomeronasal 1 receptor 189
SynonymsV1rh2
MMRRC Submission 040251-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R2251 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22099762-22105824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22102548 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 40 (K40E)
Ref Sequence ENSEMBL: ENSMUSP00000154722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186062] [ENSMUST00000227357] [ENSMUST00000228428]
Predicted Effect probably damaging
Transcript: ENSMUST00000075055
AA Change: K40E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074566
Gene: ENSMUSG00000061222
AA Change: K40E

DomainStartEndE-ValueType
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186062
AA Change: K40E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140924
Gene: ENSMUSG00000099611
AA Change: K40E

DomainStartEndE-ValueType
Pfam:7tm_1 30 283 1e-7 PFAM
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227357
AA Change: K40E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228428
AA Change: K40E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Abl1 T A 2: 31,779,119 V170E probably damaging Het
Akap13 C T 7: 75,739,477 T2381M possibly damaging Het
Armc8 T A 9: 99,502,600 probably null Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cntn2 T C 1: 132,525,321 E411G probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Fam186a T C 15: 99,945,097 T1089A probably benign Het
Fgb T G 3: 83,043,284 T388P probably damaging Het
Fndc1 G A 17: 7,753,607 R1498W probably damaging Het
Gch1 T C 14: 47,189,341 probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
H2-M10.1 A C 17: 36,325,606 L102R probably damaging Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
N4bp2 G A 5: 65,806,728 V707I probably damaging Het
Nav2 A G 7: 49,453,277 K608E probably damaging Het
Nfix T C 8: 84,716,170 D458G probably benign Het
Ngdn T C 14: 55,023,395 probably null Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr138 C T 17: 38,274,903 A44V probably benign Het
Olfr672 A T 7: 104,996,595 M103K probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pbld2 G T 10: 63,024,605 probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Pwp2 T A 10: 78,181,088 Q266L probably benign Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Scn8a A G 15: 101,017,106 I1184V probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Smim11 T C 16: 92,310,828 Y14H probably benign Het
Spata17 A T 1: 187,048,473 L359Q possibly damaging Het
Spn T C 7: 127,137,159 K59E probably benign Het
Tap2 A G 17: 34,211,954 S343G probably damaging Het
Tcp11l2 T C 10: 84,605,069 probably null Het
Tlr11 T A 14: 50,360,792 N78K probably benign Het
Tm9sf2 T A 14: 122,139,731 S224T probably benign Het
Trpm1 G A 7: 64,209,976 G261D probably damaging Het
Usp3 T C 9: 66,562,578 D87G probably damaging Het
Vps45 A T 3: 96,057,040 D56E probably benign Het
Vstm2a C A 11: 16,368,273 Q231K probably benign Het
Zcchc11 T A 4: 108,520,208 D938E probably damaging Het
Zfp575 A T 7: 24,585,590 C209S probably damaging Het
Zfp768 T C 7: 127,344,378 T193A probably benign Het
Zfp867 T A 11: 59,465,493 R38* probably null Het
Other mutations in Vmn1r189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03084:Vmn1r189 APN 13 22101838 nonsense probably null
R0437:Vmn1r189 UTSW 13 22102061 missense probably damaging 0.99
R1199:Vmn1r189 UTSW 13 22102658 missense probably damaging 0.99
R1795:Vmn1r189 UTSW 13 22102154 missense probably benign 0.03
R3751:Vmn1r189 UTSW 13 22102212 missense probably benign 0.00
R3824:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3825:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3856:Vmn1r189 UTSW 13 22102269 missense possibly damaging 0.56
R4688:Vmn1r189 UTSW 13 22102119 missense probably damaging 0.99
R5665:Vmn1r189 UTSW 13 22102166 missense probably damaging 1.00
R5778:Vmn1r189 UTSW 13 22102382 missense probably damaging 0.99
R6149:Vmn1r189 UTSW 13 22101884 missense probably benign 0.33
R6431:Vmn1r189 UTSW 13 22102355 missense probably damaging 0.98
R6660:Vmn1r189 UTSW 13 22101896 missense possibly damaging 0.89
R6974:Vmn1r189 UTSW 13 22102458 missense probably damaging 1.00
R7051:Vmn1r189 UTSW 13 22102115 missense possibly damaging 0.58
R7269:Vmn1r189 UTSW 13 22102567 missense probably benign 0.00
R7330:Vmn1r189 UTSW 13 22102541 missense possibly damaging 0.95
R7611:Vmn1r189 UTSW 13 22102152 missense probably benign 0.02
R7894:Vmn1r189 UTSW 13 22101736 nonsense probably null
R7977:Vmn1r189 UTSW 13 22101736 nonsense probably null
Z1177:Vmn1r189 UTSW 13 22101883 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGAGGAGACTTCTGGTGC -3'
(R):5'- AATGTGCTGCTCAGATCCATGTC -3'

Sequencing Primer
(F):5'- ACTTCTGGTGCAGATGGAGAG -3'
(R):5'- CTCAGATCCATGTCTAGGATTACTGG -3'
Posted On2014-10-16