Incidental Mutation 'R2251:Fam186a'
ID241701
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
MMRRC Submission 040251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2251 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99945097 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1089 (T1089A)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect probably benign
Transcript: ENSMUST00000100209
AA Change: T1089A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: T1089A

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180309
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Abl1 T A 2: 31,779,119 V170E probably damaging Het
Akap13 C T 7: 75,739,477 T2381M possibly damaging Het
Armc8 T A 9: 99,502,600 probably null Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cntn2 T C 1: 132,525,321 E411G probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Fgb T G 3: 83,043,284 T388P probably damaging Het
Fndc1 G A 17: 7,753,607 R1498W probably damaging Het
Gch1 T C 14: 47,189,341 probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
H2-M10.1 A C 17: 36,325,606 L102R probably damaging Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
N4bp2 G A 5: 65,806,728 V707I probably damaging Het
Nav2 A G 7: 49,453,277 K608E probably damaging Het
Nfix T C 8: 84,716,170 D458G probably benign Het
Ngdn T C 14: 55,023,395 probably null Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr138 C T 17: 38,274,903 A44V probably benign Het
Olfr672 A T 7: 104,996,595 M103K probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pbld2 G T 10: 63,024,605 probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Pwp2 T A 10: 78,181,088 Q266L probably benign Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Scn8a A G 15: 101,017,106 I1184V probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Smim11 T C 16: 92,310,828 Y14H probably benign Het
Spata17 A T 1: 187,048,473 L359Q possibly damaging Het
Spn T C 7: 127,137,159 K59E probably benign Het
Tap2 A G 17: 34,211,954 S343G probably damaging Het
Tcp11l2 T C 10: 84,605,069 probably null Het
Tlr11 T A 14: 50,360,792 N78K probably benign Het
Tm9sf2 T A 14: 122,139,731 S224T probably benign Het
Trpm1 G A 7: 64,209,976 G261D probably damaging Het
Usp3 T C 9: 66,562,578 D87G probably damaging Het
Vmn1r189 T C 13: 22,102,548 K40E probably damaging Het
Vps45 A T 3: 96,057,040 D56E probably benign Het
Vstm2a C A 11: 16,368,273 Q231K probably benign Het
Zcchc11 T A 4: 108,520,208 D938E probably damaging Het
Zfp575 A T 7: 24,585,590 C209S probably damaging Het
Zfp768 T C 7: 127,344,378 T193A probably benign Het
Zfp867 T A 11: 59,465,493 R38* probably null Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7244:Fam186a UTSW 15 99946392 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7658:Fam186a UTSW 15 99939844 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCAGGGGTGAAAGTGATC -3'
(R):5'- GTCAAGGCACAGAGGGTCAATC -3'

Sequencing Primer
(F):5'- ATCAGGGCTCAGATTGATTCTC -3'
(R):5'- GCACAGAGGGTCAATCTGATC -3'
Posted On2014-10-16