Incidental Mutation 'R2251:Mbtps2'
ID241714
Institutional Source Beutler Lab
Gene Symbol Mbtps2
Ensembl Gene ENSMUSG00000046873
Gene Namemembrane-bound transcription factor peptidase, site 2
Synonyms9630032G22Rik
MMRRC Submission 040251-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2251 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location157535371-157598715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 157559033 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 270 (F270L)
Ref Sequence ENSEMBL: ENSMUSP00000059471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058098]
Predicted Effect probably benign
Transcript: ENSMUST00000058098
AA Change: F270L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000059471
Gene: ENSMUSG00000046873
AA Change: F270L

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
Pfam:Peptidase_M50 155 514 4.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065857
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a intramembrane zinc metalloprotease, which is essential in development. This protease functions in the signal protein activation involved in sterol control of transcription and the ER stress response. Mutations in this gene have been associated with ichthyosis follicularis with atrichia and photophobia (IFAP syndrome); IFAP syndrome has been quantitatively linked to a reduction in cholesterol homeostasis and ER stress response.[provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Abl1 T A 2: 31,779,119 V170E probably damaging Het
Akap13 C T 7: 75,739,477 T2381M possibly damaging Het
Armc8 T A 9: 99,502,600 probably null Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cntn2 T C 1: 132,525,321 E411G probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Fam186a T C 15: 99,945,097 T1089A probably benign Het
Fgb T G 3: 83,043,284 T388P probably damaging Het
Fndc1 G A 17: 7,753,607 R1498W probably damaging Het
Gch1 T C 14: 47,189,341 probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
H2-M10.1 A C 17: 36,325,606 L102R probably damaging Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
N4bp2 G A 5: 65,806,728 V707I probably damaging Het
Nav2 A G 7: 49,453,277 K608E probably damaging Het
Nfix T C 8: 84,716,170 D458G probably benign Het
Ngdn T C 14: 55,023,395 probably null Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr138 C T 17: 38,274,903 A44V probably benign Het
Olfr672 A T 7: 104,996,595 M103K probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pbld2 G T 10: 63,024,605 probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Pwp2 T A 10: 78,181,088 Q266L probably benign Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Scn8a A G 15: 101,017,106 I1184V probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Smim11 T C 16: 92,310,828 Y14H probably benign Het
Spata17 A T 1: 187,048,473 L359Q possibly damaging Het
Spn T C 7: 127,137,159 K59E probably benign Het
Tap2 A G 17: 34,211,954 S343G probably damaging Het
Tcp11l2 T C 10: 84,605,069 probably null Het
Tlr11 T A 14: 50,360,792 N78K probably benign Het
Tm9sf2 T A 14: 122,139,731 S224T probably benign Het
Trpm1 G A 7: 64,209,976 G261D probably damaging Het
Usp3 T C 9: 66,562,578 D87G probably damaging Het
Vmn1r189 T C 13: 22,102,548 K40E probably damaging Het
Vps45 A T 3: 96,057,040 D56E probably benign Het
Vstm2a C A 11: 16,368,273 Q231K probably benign Het
Zcchc11 T A 4: 108,520,208 D938E probably damaging Het
Zfp575 A T 7: 24,585,590 C209S probably damaging Het
Zfp768 T C 7: 127,344,378 T193A probably benign Het
Zfp867 T A 11: 59,465,493 R38* probably null Het
Other mutations in Mbtps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mbtps2 UTSW X 157568368 missense probably benign 0.01
R2253:Mbtps2 UTSW X 157559033 missense probably benign 0.03
R5365:Mbtps2 UTSW X 157568299 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGACTAGTACTTGAAGCATTGTG -3'
(R):5'- CTGCTTTGAAGAAAACTCTAAGCTG -3'

Sequencing Primer
(F):5'- GTGTCATATCAAGTAAATGCACACAC -3'
(R):5'- ACTCTAAGCTGAATGAAAAGGAATG -3'
Posted On2014-10-16