Incidental Mutation 'R2252:Olfr988'
ID241722
Institutional Source Beutler Lab
Gene Symbol Olfr988
Ensembl Gene ENSMUSG00000075222
Gene Nameolfactory receptor 988
SynonymsGA_x6K02T2Q125-46830591-46829662, MOR203-5P
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85352428-85363227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85353858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000151211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099928] [ENSMUST00000111597] [ENSMUST00000215511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099928
AA Change: S23P

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097512
Gene: ENSMUSG00000075222
AA Change: S23P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 3.8e-31 PFAM
Pfam:7tm_4 139 283 3.7e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111597
AA Change: S23P

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107224
Gene: ENSMUSG00000075222
AA Change: S23P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.1e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 7.4e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215511
AA Change: S23P

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Olfr988
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Olfr988 APN 2 85353662 missense probably benign 0.01
IGL02651:Olfr988 APN 2 85353050 missense probably damaging 1.00
R0505:Olfr988 UTSW 2 85353749 missense possibly damaging 0.87
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1632:Olfr988 UTSW 2 85353242 missense possibly damaging 0.78
R2187:Olfr988 UTSW 2 85353915 missense probably benign
R2251:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R2253:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R3522:Olfr988 UTSW 2 85353003 missense probably benign 0.06
R4804:Olfr988 UTSW 2 85353081 missense probably benign 0.22
R4855:Olfr988 UTSW 2 85353449 missense possibly damaging 0.89
R4895:Olfr988 UTSW 2 85352997 makesense probably null
R4918:Olfr988 UTSW 2 85353288 missense probably benign 0.39
R5171:Olfr988 UTSW 2 85353770 missense probably benign 0.11
R5208:Olfr988 UTSW 2 85353798 missense probably benign 0.07
R5938:Olfr988 UTSW 2 85353276 missense probably damaging 1.00
R6088:Olfr988 UTSW 2 85353354 missense probably damaging 0.99
R7213:Olfr988 UTSW 2 85353556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACATCTTGGGAGTAATAGCTGAGG -3'
(R):5'- GGAACTGCATAAGCTAACATGC -3'

Sequencing Primer
(F):5'- CTTGGGAGTAATAGCTGAGGTATAGC -3'
(R):5'- CATTGCAACTCTTCACGTG -3'
Posted On2014-10-16