Incidental Mutation 'R2252:Pcif1'
ID241730
Institutional Source Beutler Lab
Gene Symbol Pcif1
Ensembl Gene ENSMUSG00000039849
Gene NamePDX1 C-terminal inhibiting factor 1
Synonyms
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R2252 (G1)
Quality Score197
Status Not validated
Chromosome2
Chromosomal Location164879304-164894454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164890879 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 628 (E628G)
Ref Sequence ENSEMBL: ENSMUSP00000039555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
AA Change: E628G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849
AA Change: E628G

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Pcif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Pcif1 APN 2 164885788 missense probably damaging 1.00
IGL01598:Pcif1 APN 2 164886611 missense possibly damaging 0.86
R0313:Pcif1 UTSW 2 164884419 missense probably damaging 0.97
R0329:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R0330:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R1070:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1350:Pcif1 UTSW 2 164886767 missense probably damaging 0.99
R1467:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1467:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1583:Pcif1 UTSW 2 164886727 missense probably damaging 1.00
R1640:Pcif1 UTSW 2 164885683 missense probably benign
R1852:Pcif1 UTSW 2 164888466 missense probably damaging 0.97
R2571:Pcif1 UTSW 2 164884211 missense probably damaging 1.00
R3879:Pcif1 UTSW 2 164885958 missense probably benign 0.40
R4956:Pcif1 UTSW 2 164889690 missense probably damaging 1.00
R5792:Pcif1 UTSW 2 164885379 missense probably damaging 0.97
R5913:Pcif1 UTSW 2 164884492 intron probably benign
R6798:Pcif1 UTSW 2 164885791 missense possibly damaging 0.94
R6913:Pcif1 UTSW 2 164884304 critical splice acceptor site probably null
R7359:Pcif1 UTSW 2 164884331 missense probably damaging 1.00
R7453:Pcif1 UTSW 2 164888364 missense probably damaging 1.00
R7453:Pcif1 UTSW 2 164889630 missense possibly damaging 0.94
R7917:Pcif1 UTSW 2 164888472 missense probably benign 0.08
R8031:Pcif1 UTSW 2 164886522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAACTGCTGGAGAGCTC -3'
(R):5'- TAAGTGGGGTGAGGCTCTCTAC -3'

Sequencing Primer
(F):5'- CATCGTGTTCATCCCGGAGTG -3'
(R):5'- ACTAGGGCCCTGTTCCC -3'
Posted On2014-10-16