Incidental Mutation 'R2252:Drc1'
ID241737
Institutional Source Beutler Lab
Gene Symbol Drc1
Ensembl Gene ENSMUSG00000073102
Gene Namedynein regulatory complex subunit 1
SynonymsCcdc164, Gm1060, LOC381738, b2b1654Clo
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30281388-30366695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30342731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 103 (V103F)
Ref Sequence ENSEMBL: ENSMUSP00000098992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101448]
Predicted Effect probably benign
Transcript: ENSMUST00000101448
AA Change: V103F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102
AA Change: V103F

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
Pfam:NYD-SP28 100 200 1.7e-33 PFAM
coiled coil region 280 318 N/A INTRINSIC
low complexity region 455 473 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
low complexity region 599 612 N/A INTRINSIC
Pfam:NYD-SP28_assoc 673 732 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200399
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central component of the nexin-dynein complex (N-DRC), which regulates the assembly of ciliary dynein. Mutations in this gene can cause ciliary dyskinesia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit heterotaxy with complex congenital heart disease such as transposition of the great arteries (TGA), atrioventricular septal defects (AVSD), and vein abnormalities; immotile/dyskinetic airway cilia are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Drc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Drc1 APN 5 30345663 missense probably damaging 1.00
IGL02123:Drc1 APN 5 30347104 missense probably benign 0.07
IGL02839:Drc1 APN 5 30350423 missense probably benign 0.02
putative UTSW 5 30356288 missense probably benign 0.11
PIT4431001:Drc1 UTSW 5 30347073 missense probably damaging 0.98
R0147:Drc1 UTSW 5 30281489 missense possibly damaging 0.90
R0148:Drc1 UTSW 5 30281489 missense possibly damaging 0.90
R0590:Drc1 UTSW 5 30363136 missense probably benign 0.00
R1640:Drc1 UTSW 5 30363957 missense possibly damaging 0.81
R1799:Drc1 UTSW 5 30366497 missense probably damaging 1.00
R2105:Drc1 UTSW 5 30356441 missense probably benign 0.01
R2366:Drc1 UTSW 5 30366550 makesense probably null
R2570:Drc1 UTSW 5 30355265 missense probably damaging 1.00
R4036:Drc1 UTSW 5 30347182 missense probably benign
R4181:Drc1 UTSW 5 30355713 missense probably benign 0.16
R4210:Drc1 UTSW 5 30347146 missense possibly damaging 0.47
R4329:Drc1 UTSW 5 30355658 missense probably benign 0.16
R4560:Drc1 UTSW 5 30363097 missense probably benign
R4765:Drc1 UTSW 5 30348731 missense probably benign 0.04
R5239:Drc1 UTSW 5 30363123 missense probably benign 0.00
R5375:Drc1 UTSW 5 30356401 missense probably benign
R5838:Drc1 UTSW 5 30366513 splice site probably null
R5933:Drc1 UTSW 5 30345529 missense probably damaging 0.99
R6014:Drc1 UTSW 5 30345649 missense probably damaging 1.00
R6408:Drc1 UTSW 5 30356288 missense probably benign 0.11
R6710:Drc1 UTSW 5 30363085 missense possibly damaging 0.83
R6755:Drc1 UTSW 5 30355146 missense probably damaging 1.00
R7341:Drc1 UTSW 5 30364468 missense probably damaging 1.00
R7592:Drc1 UTSW 5 30341716 missense possibly damaging 0.75
R7651:Drc1 UTSW 5 30359614 missense probably benign 0.02
R7770:Drc1 UTSW 5 30350512 nonsense probably null
R7976:Drc1 UTSW 5 30364485 missense probably benign 0.05
X0018:Drc1 UTSW 5 30345544 missense probably damaging 1.00
X0021:Drc1 UTSW 5 30356423 missense probably benign 0.38
Z1177:Drc1 UTSW 5 30345507 missense possibly damaging 0.49
Z1177:Drc1 UTSW 5 30348697 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCTACTTATGTGCCCCGGG -3'
(R):5'- GCTTGGGACACTTGAGGAAG -3'

Sequencing Primer
(F):5'- TGATTCCTACAGTGCGGGTCC -3'
(R):5'- AGGACGGTGGGTTCACAC -3'
Posted On2014-10-16