Incidental Mutation 'R0166:Mrpl23'
ID24174
Institutional Source Beutler Lab
Gene Symbol Mrpl23
Ensembl Gene ENSMUSG00000037772
Gene Namemitochondrial ribosomal protein L23
SynonymsL23mrp, Rpl23l
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location142532686-142540747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142535114 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 69 (R69W)
Ref Sequence ENSEMBL: ENSMUSP00000148138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038675] [ENSMUST00000210662] [ENSMUST00000210803]
Predicted Effect probably damaging
Transcript: ENSMUST00000038675
AA Change: R43W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039784
Gene: ENSMUSG00000037772
AA Change: R43W

DomainStartEndE-ValueType
Pfam:Ribosomal_L23 29 107 1.3e-15 PFAM
low complexity region 116 133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209576
Predicted Effect probably damaging
Transcript: ENSMUST00000210662
AA Change: R69W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210803
Meta Mutation Damage Score 0.2779 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y264* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Mrpl23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Mrpl23 APN 7 142536065 splice site probably benign
IGL02061:Mrpl23 APN 7 142540582 missense probably benign 0.00
IGL02350:Mrpl23 APN 7 142536065 splice site probably benign
IGL02357:Mrpl23 APN 7 142536065 splice site probably benign
R5420:Mrpl23 UTSW 7 142536137 missense probably damaging 1.00
R6569:Mrpl23 UTSW 7 142535039 missense probably damaging 1.00
R7477:Mrpl23 UTSW 7 142537281 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTAGTGTCAGTAGCCCTGGAACC -3'
(R):5'- TGCCTGAAGCTCTGCAAACACC -3'

Sequencing Primer
(F):5'- GACAGGTCCTATGTGTAACTGTCC -3'
(R):5'- TCTGCAAACACCAGGCCC -3'
Posted On2013-04-16