Incidental Mutation 'R2252:Zfp536'
ID241744
Institutional Source Beutler Lab
Gene Symbol Zfp536
Ensembl Gene ENSMUSG00000043456
Gene Namezinc finger protein 536
Synonyms
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location37472135-37773641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37479389 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 200 (S200G)
Ref Sequence ENSEMBL: ENSMUSP00000135234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056338] [ENSMUST00000175941] [ENSMUST00000176114] [ENSMUST00000176129] [ENSMUST00000176205]
Predicted Effect probably benign
Transcript: ENSMUST00000056338
AA Change: S1264G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058468
Gene: ENSMUSG00000043456
AA Change: S1264G

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
Pfam:zf-C2H2_assoc 657 739 6.6e-43 PFAM
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175941
AA Change: S1264G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134778
Gene: ENSMUSG00000043456
AA Change: S1264G

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176114
AA Change: S1264G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135681
Gene: ENSMUSG00000043456
AA Change: S1264G

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176129
AA Change: S200G

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135234
Gene: ENSMUSG00000043456
AA Change: S200G

DomainStartEndE-ValueType
low complexity region 134 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176205
AA Change: S1264G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135068
Gene: ENSMUSG00000043456
AA Change: S1264G

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a highly conserved zinc finger protein. The encoded protein is most abundant in brain, where it negatively regulates neuronal differentiation. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Zfp536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Zfp536 APN 7 37567890 missense probably damaging 0.99
IGL02729:Zfp536 APN 7 37493718 missense probably damaging 1.00
PIT4453001:Zfp536 UTSW 7 37479757 missense probably benign 0.08
R0211:Zfp536 UTSW 7 37568449 missense probably damaging 1.00
R0369:Zfp536 UTSW 7 37567948 missense probably damaging 1.00
R0504:Zfp536 UTSW 7 37568818 missense probably damaging 1.00
R0554:Zfp536 UTSW 7 37480819 missense probably damaging 1.00
R1171:Zfp536 UTSW 7 37569634 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1699:Zfp536 UTSW 7 37569454 missense probably damaging 1.00
R1817:Zfp536 UTSW 7 37568617 missense probably damaging 1.00
R1918:Zfp536 UTSW 7 37480199 missense probably damaging 1.00
R2288:Zfp536 UTSW 7 37480348 missense probably damaging 0.98
R2509:Zfp536 UTSW 7 37567978 missense possibly damaging 0.87
R3967:Zfp536 UTSW 7 37473830 makesense probably null
R4039:Zfp536 UTSW 7 37569550 missense probably damaging 1.00
R4600:Zfp536 UTSW 7 37568493 missense probably damaging 1.00
R4706:Zfp536 UTSW 7 37569466 missense probably damaging 1.00
R4771:Zfp536 UTSW 7 37568884 missense probably damaging 1.00
R4808:Zfp536 UTSW 7 37479305 missense probably damaging 1.00
R4945:Zfp536 UTSW 7 37569736 missense probably damaging 1.00
R5196:Zfp536 UTSW 7 37480760 missense probably damaging 1.00
R5506:Zfp536 UTSW 7 37568792 missense probably damaging 1.00
R5816:Zfp536 UTSW 7 37480628 missense probably damaging 1.00
R6114:Zfp536 UTSW 7 37479736 missense probably damaging 0.99
R6131:Zfp536 UTSW 7 37569712 missense probably damaging 1.00
R6156:Zfp536 UTSW 7 37473856 missense unknown
R6257:Zfp536 UTSW 7 37480405 missense probably damaging 1.00
R6864:Zfp536 UTSW 7 37568515 missense probably damaging 1.00
R6975:Zfp536 UTSW 7 37568527 missense probably damaging 1.00
R6976:Zfp536 UTSW 7 37480403 missense probably damaging 1.00
R7176:Zfp536 UTSW 7 37480851 critical splice acceptor site probably null
R7247:Zfp536 UTSW 7 37569206 missense probably benign 0.04
R7325:Zfp536 UTSW 7 37479860 missense probably benign
R7650:Zfp536 UTSW 7 37569692 missense probably damaging 1.00
R7782:Zfp536 UTSW 7 37568701 missense probably damaging 1.00
R7827:Zfp536 UTSW 7 37569688 missense probably damaging 1.00
R8013:Zfp536 UTSW 7 37569610 missense probably damaging 1.00
R8209:Zfp536 UTSW 7 37568655 missense probably benign 0.00
R8504:Zfp536 UTSW 7 37480067 missense probably benign
X0066:Zfp536 UTSW 7 37569781 missense possibly damaging 0.93
Z1176:Zfp536 UTSW 7 37493812 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGCACAATTTAGCAGTGACG -3'
(R):5'- AGAAATGACGAGCAAGCCTCTG -3'

Sequencing Primer
(F):5'- GCACAATTTAGCAGTGACGTTTTTG -3'
(R):5'- TCTCAGCAAGGATGGCAGC -3'
Posted On2014-10-16