Incidental Mutation 'R2252:Slc7a2'
ID241747
Institutional Source Beutler Lab
Gene Symbol Slc7a2
Ensembl Gene ENSMUSG00000031596
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 2
SynonymsTea, Cat2, Atrc2
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40862396-40922308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40905621 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 334 (Y334H)
Ref Sequence ENSEMBL: ENSMUSP00000112848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057784] [ENSMUST00000098816] [ENSMUST00000117077] [ENSMUST00000118432]
Predicted Effect probably benign
Transcript: ENSMUST00000057784
AA Change: Y317H

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058866
Gene: ENSMUSG00000031596
AA Change: Y317H

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 450 1.4e-55 PFAM
Pfam:AA_permease 38 442 9.7e-38 PFAM
transmembrane domain 492 514 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:AA_permease_C 555 605 4.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098816
AA Change: Y317H

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096414
Gene: ENSMUSG00000031596
AA Change: Y317H

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 451 8.9e-54 PFAM
Pfam:AA_permease 38 443 5.8e-35 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 4.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117077
AA Change: Y317H

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113729
Gene: ENSMUSG00000031596
AA Change: Y317H

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 454 2e-52 PFAM
Pfam:AA_permease 38 440 4.8e-33 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118432
AA Change: Y334H

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112848
Gene: ENSMUSG00000031596
AA Change: Y334H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:AA_permease_2 51 469 5.1e-54 PFAM
Pfam:AA_permease 55 456 5.1e-36 PFAM
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 541 560 N/A INTRINSIC
Pfam:AA_permease_C 572 622 2.5e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cationic amino acid transporter and a member of the APC (amino acid-polyamine-organocation) family of transporters. The encoded membrane protein is responsible for the cellular uptake of arginine, lysine and ornithine. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a marked reduction of nitric oxide production by cytokine-activated macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Slc7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc7a2 APN 8 40905622 missense possibly damaging 0.57
IGL00948:Slc7a2 APN 8 40912524 missense probably benign 0.04
IGL01565:Slc7a2 APN 8 40899238 missense possibly damaging 0.94
IGL01590:Slc7a2 APN 8 40914100 missense probably damaging 1.00
IGL01939:Slc7a2 APN 8 40914083 missense possibly damaging 0.93
IGL02043:Slc7a2 APN 8 40911058 missense probably benign 0.35
IGL02101:Slc7a2 APN 8 40902594 missense probably benign 0.07
IGL02238:Slc7a2 APN 8 40908156 missense probably benign
IGL02385:Slc7a2 APN 8 40899011 missense probably damaging 0.98
IGL02562:Slc7a2 APN 8 40915020 missense probably damaging 1.00
IGL02962:Slc7a2 APN 8 40905584 missense probably damaging 0.98
IGL03268:Slc7a2 APN 8 40912517 missense probably benign 0.00
IGL03285:Slc7a2 APN 8 40914993 missense possibly damaging 0.50
IGL03345:Slc7a2 APN 8 40916493 missense probably benign 0.25
IGL03375:Slc7a2 APN 8 40916373 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0437:Slc7a2 UTSW 8 40904526 missense probably damaging 1.00
R0624:Slc7a2 UTSW 8 40908531 missense probably benign 0.34
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1908:Slc7a2 UTSW 8 40916497 missense probably benign
R1959:Slc7a2 UTSW 8 40914965 missense probably damaging 0.97
R2251:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2253:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R3498:Slc7a2 UTSW 8 40912530 missense probably benign 0.11
R3899:Slc7a2 UTSW 8 40905553 missense possibly damaging 0.93
R4440:Slc7a2 UTSW 8 40902649 missense probably benign
R4785:Slc7a2 UTSW 8 40911058 missense probably benign 0.18
R4788:Slc7a2 UTSW 8 40913986 missense probably benign
R4826:Slc7a2 UTSW 8 40911046 missense probably damaging 1.00
R4996:Slc7a2 UTSW 8 40912562 nonsense probably null
R5249:Slc7a2 UTSW 8 40908093 missense possibly damaging 0.77
R5314:Slc7a2 UTSW 8 40915030 critical splice donor site probably null
R5408:Slc7a2 UTSW 8 40915005 missense probably damaging 1.00
R5537:Slc7a2 UTSW 8 40913986 missense probably benign 0.10
R6116:Slc7a2 UTSW 8 40900169 missense probably damaging 0.98
R7139:Slc7a2 UTSW 8 40915013 missense probably benign 0.01
R7389:Slc7a2 UTSW 8 40912515 missense probably benign
R7451:Slc7a2 UTSW 8 40912649 missense probably damaging 0.99
R7979:Slc7a2 UTSW 8 40904504 missense probably damaging 1.00
R8415:Slc7a2 UTSW 8 40916359 missense probably damaging 1.00
X0062:Slc7a2 UTSW 8 40914963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGGAGGCTTTGACCAC -3'
(R):5'- CAGGTCAAGCATTCTACCACTG -3'

Sequencing Primer
(F):5'- GAGGCTTTGACCACAGTAAGTCC -3'
(R):5'- GAGCAACTCTGAAGCCACTTG -3'
Posted On2014-10-16