Incidental Mutation 'R2252:Cldn24'
ID241749
Institutional Source Beutler Lab
Gene Symbol Cldn24
Ensembl Gene ENSMUSG00000061974
Gene Nameclaudin 24
SynonymsGm10107
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2252 (G1)
Quality Score119
Status Not validated
Chromosome8
Chromosomal Location47822143-47822805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47822328 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 62 (R62S)
Ref Sequence ENSEMBL: ENSMUSP00000078584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038693] [ENSMUST00000057561] [ENSMUST00000079639]
Predicted Effect probably benign
Transcript: ENSMUST00000038693
SMART Domains Protein: ENSMUSP00000041676
Gene: ENSMUSG00000038064

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 6.2e-23 PFAM
Pfam:Claudin_2 18 184 1.8e-9 PFAM
low complexity region 185 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057561
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079639
AA Change: R62S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078584
Gene: ENSMUSG00000061974
AA Change: R62S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 9.1e-25 PFAM
Pfam:Claudin_2 18 184 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212295
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is 75% identical to the human homolog. Similar to the human gene, this gene is upstream of the Cldn22 gene, which overlaps the Wwc2 gene on the opposite strand. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Cldn24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2253:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R2309:Cldn24 UTSW 8 47822739 nonsense probably null
R6265:Cldn24 UTSW 8 47822339 missense probably benign 0.00
R6818:Cldn24 UTSW 8 47822722 missense probably benign 0.03
R7688:Cldn24 UTSW 8 47822705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCATCTTCAGAACGGCCATG -3'
(R):5'- GGAACTAGCACCATGACTCC -3'

Sequencing Primer
(F):5'- CATGCAATCAGTAGGGCTTTC -3'
(R):5'- ATGACTCCCGAGGTCCAGAG -3'
Posted On2014-10-16