Incidental Mutation 'R2252:Yjefn3'
ID241751
Institutional Source Beutler Lab
Gene Symbol Yjefn3
Ensembl Gene ENSMUSG00000048967
Gene NameYjeF N-terminal domain containing 3
SynonymsLOC234365
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69887788-69902712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 69889445 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 42 (F42V)
Ref Sequence ENSEMBL: ENSMUSP00000136145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057831] [ENSMUST00000110167] [ENSMUST00000152938] [ENSMUST00000180068]
Predicted Effect probably benign
Transcript: ENSMUST00000057831
SMART Domains Protein: ENSMUSP00000061544
Gene: ENSMUSG00000044006

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin2_WxxW 58 143 2.5e-22 PFAM
TSP1 149 197 1.33e-9 SMART
Pfam:CarboxypepD_reg 210 288 4.5e-10 PFAM
IGc2 305 367 2.52e-9 SMART
low complexity region 472 481 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 693 703 N/A INTRINSIC
low complexity region 705 719 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110167
SMART Domains Protein: ENSMUSP00000105796
Gene: ENSMUSG00000036199

DomainStartEndE-ValueType
Pfam:GRIM-19 5 129 9.6e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152456
Predicted Effect probably damaging
Transcript: ENSMUST00000152938
AA Change: F95V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118931
Gene: ENSMUSG00000048967
AA Change: F95V

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:YjeF_N 17 187 5.1e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180068
AA Change: F42V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967
AA Change: F42V

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Yjefn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03065:Yjefn3 APN 8 69889556 splice site probably benign
R1519:Yjefn3 UTSW 8 69889079 missense probably benign 0.00
R1992:Yjefn3 UTSW 8 69888995 critical splice donor site probably null
R2080:Yjefn3 UTSW 8 69889487 missense probably damaging 1.00
R4213:Yjefn3 UTSW 8 69890890 missense probably benign 0.15
R5776:Yjefn3 UTSW 8 69889471 missense probably damaging 1.00
R7644:Yjefn3 UTSW 8 69887894 missense probably damaging 0.99
Z1176:Yjefn3 UTSW 8 69889119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGTCCATCTTCTCGCACTG -3'
(R):5'- GGTTCACATTCTGCCTGAGC -3'

Sequencing Primer
(F):5'- ACTGCGTGGTCAGGTCAC -3'
(R):5'- AAGGTCTGCCTGCCTGC -3'
Posted On2014-10-16