Incidental Mutation 'R2252:B3gnt3'
ID241752
Institutional Source Beutler Lab
Gene Symbol B3gnt3
Ensembl Gene ENSMUSG00000031803
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Synonyms2210008L19Rik
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71690756-71701789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71692818 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 302 (M302K)
Ref Sequence ENSEMBL: ENSMUSP00000034260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034260] [ENSMUST00000034261] [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably damaging
Transcript: ENSMUST00000034260
AA Change: M302K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034260
Gene: ENSMUSG00000031803
AA Change: M302K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Galactosyl_T 121 314 5.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034261
SMART Domains Protein: ENSMUSP00000034261
Gene: ENSMUSG00000079019

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
IlGF 26 120 2.46e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051995
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110012
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110013
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212491
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein and contains a signal anchor that is not cleaved. It prefers the substrates of lacto-N-tetraose and lacto-N-neotetraose, and is involved in the biosynthesis of poly-N-acetyllactosamine chains and the biosynthesis of the backbone structure of dimeric sialyl Lewis a. It plays dominant roles in L-selectin ligand biosynthesis, lymphocyte homing and lymphocyte trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display increases in thermal pain sensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in B3gnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:B3gnt3 APN 8 71693004 missense possibly damaging 0.57
R0046:B3gnt3 UTSW 8 71692923 missense probably damaging 1.00
R0046:B3gnt3 UTSW 8 71692923 missense probably damaging 1.00
R0652:B3gnt3 UTSW 8 71693822 missense probably benign 0.01
R1104:B3gnt3 UTSW 8 71693837 missense possibly damaging 0.93
R2125:B3gnt3 UTSW 8 71693358 missense probably damaging 1.00
R2132:B3gnt3 UTSW 8 71693327 missense probably damaging 1.00
R2251:B3gnt3 UTSW 8 71692818 missense probably damaging 1.00
R2253:B3gnt3 UTSW 8 71692818 missense probably damaging 1.00
R4418:B3gnt3 UTSW 8 71693769 missense probably benign 0.03
R4854:B3gnt3 UTSW 8 71692873 missense probably damaging 1.00
R4911:B3gnt3 UTSW 8 71692934 missense probably benign 0.00
R5042:B3gnt3 UTSW 8 71692888 missense probably damaging 1.00
R5778:B3gnt3 UTSW 8 71692938 missense probably benign 0.02
R6249:B3gnt3 UTSW 8 71692662 missense probably damaging 1.00
R7585:B3gnt3 UTSW 8 71693328 missense probably damaging 1.00
R7853:B3gnt3 UTSW 8 71692713 missense probably damaging 1.00
R8191:B3gnt3 UTSW 8 71693478 missense probably benign 0.06
Z1088:B3gnt3 UTSW 8 71693765 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTCAGCGCATCCCACATCAG -3'
(R):5'- CGGACAACATGGTCACCTAC -3'

Sequencing Primer
(F):5'- CATCAGCAGCATCTCGAAGGG -3'
(R):5'- ACCAACACCTCTTCGTGGG -3'
Posted On2014-10-16