Incidental Mutation 'R2252:Pknox2'
ID241757
Institutional Source Beutler Lab
Gene Symbol Pknox2
Ensembl Gene ENSMUSG00000035934
Gene NamePbx/knotted 1 homeobox 2
SynonymsD230005H23Rik, Prep2
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36890982-37147407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36910520 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 270 (N270D)
Ref Sequence ENSEMBL: ENSMUSP00000135581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039674] [ENSMUST00000080754] [ENSMUST00000175938] [ENSMUST00000177218]
Predicted Effect probably benign
Transcript: ENSMUST00000039674
AA Change: N270D

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035806
Gene: ENSMUSG00000035934
AA Change: N270D

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080754
AA Change: N270D

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079578
Gene: ENSMUSG00000035934
AA Change: N270D

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175938
Predicted Effect probably benign
Transcript: ENSMUST00000176471
AA Change: N270D

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135249
Gene: ENSMUSG00000035934
AA Change: N270D

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 96 181 4.6e-42 PFAM
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177080
SMART Domains Protein: ENSMUSP00000135444
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
HOX 259 324 4.4e-14 SMART
low complexity region 386 395 N/A INTRINSIC
coiled coil region 399 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177218
AA Change: N270D

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135581
Gene: ENSMUSG00000035934
AA Change: N270D

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins are sequence-specific transcription factors that share a highly conserved DNA-binding domain and play fundamental roles in cell proliferation, differentiation, and death. PKNOX2 belongs to the TALE (3-amino acid loop extension) class of homeodomain proteins characterized by a 3-amino acid extension between alpha helices 1 and 2 within the homeodomain (Imoto et al., 2001 [PubMed 11549286]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Pknox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Pknox2 APN 9 36923742 missense probably damaging 1.00
IGL02019:Pknox2 APN 9 36923633 missense probably damaging 1.00
IGL02706:Pknox2 APN 9 36936379 missense probably benign 0.18
IGL03018:Pknox2 APN 9 36954697 missense probably damaging 1.00
IGL03374:Pknox2 APN 9 36923670 missense probably damaging 0.98
PIT4494001:Pknox2 UTSW 9 36954691 critical splice donor site probably null
R0585:Pknox2 UTSW 9 36909760 splice site probably benign
R1786:Pknox2 UTSW 9 36909684 missense probably damaging 1.00
R1843:Pknox2 UTSW 9 36954831 missense possibly damaging 0.77
R1861:Pknox2 UTSW 9 36923661 missense probably damaging 1.00
R2696:Pknox2 UTSW 9 36909691 nonsense probably null
R2843:Pknox2 UTSW 9 36894328 missense probably benign 0.00
R4576:Pknox2 UTSW 9 36923548 intron probably benign
R4632:Pknox2 UTSW 9 36894413 missense probably benign 0.00
R4705:Pknox2 UTSW 9 36923638 missense possibly damaging 0.92
R4754:Pknox2 UTSW 9 36909720 missense probably damaging 0.98
R5974:Pknox2 UTSW 9 36936322 missense probably damaging 1.00
R5984:Pknox2 UTSW 9 36923726 missense probably damaging 1.00
R7014:Pknox2 UTSW 9 36909667 missense probably damaging 1.00
R7387:Pknox2 UTSW 9 36957068 intron probably benign
R7488:Pknox2 UTSW 9 36954831 missense probably benign 0.26
R7769:Pknox2 UTSW 9 36895306 splice site probably null
R7914:Pknox2 UTSW 9 36892823 makesense probably null
R8221:Pknox2 UTSW 9 36909744 missense possibly damaging 0.86
R8296:Pknox2 UTSW 9 36911163 missense probably benign 0.31
RF016:Pknox2 UTSW 9 36909609 critical splice donor site probably benign
RF061:Pknox2 UTSW 9 36909609 critical splice donor site probably benign
X0063:Pknox2 UTSW 9 36923769 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGGAGGCAGCAAAATCCC -3'
(R):5'- TGAGAGTGCCAAGCAACTGG -3'

Sequencing Primer
(F):5'- GAGGCAGCAAAATCCCCAGAG -3'
(R):5'- AAGCAACTGGGACCCCTG -3'
Posted On2014-10-16