Incidental Mutation 'R2252:Olfr143'
ID241758
Institutional Source Beutler Lab
Gene Symbol Olfr143
Ensembl Gene ENSMUSG00000094778
Gene Nameolfactory receptor 143
SynonymsK18, GA_x6K02T2PVTD-31941084-31942025, MOR170-6
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38252774-38256549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38253830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000149842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093865] [ENSMUST00000212354] [ENSMUST00000213129]
Predicted Effect probably benign
Transcript: ENSMUST00000093865
AA Change: I138V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091388
Gene: ENSMUSG00000094778
AA Change: I138V

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1e-49 PFAM
Pfam:7tm_1 44 293 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212354
AA Change: I135V
Predicted Effect probably benign
Transcript: ENSMUST00000213129
AA Change: I135V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Olfr143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02269:Olfr143 APN 9 38253936 missense possibly damaging 0.82
R0417:Olfr143 UTSW 9 38253864 missense probably benign 0.03
R1191:Olfr143 UTSW 9 38254205 missense probably damaging 0.99
R1863:Olfr143 UTSW 9 38253720 missense probably damaging 0.99
R1868:Olfr143 UTSW 9 38253690 missense probably damaging 1.00
R5128:Olfr143 UTSW 9 38253570 missense probably damaging 1.00
R7254:Olfr143 UTSW 9 38253423 missense probably benign 0.04
R7455:Olfr143 UTSW 9 38254254 missense probably damaging 0.98
R7504:Olfr143 UTSW 9 38254243 missense possibly damaging 0.60
R7881:Olfr143 UTSW 9 38254110 missense probably benign 0.31
Z1176:Olfr143 UTSW 9 38253852 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGGTCTTTACACCCAAAATGTTG -3'
(R):5'- TGATAGCTGAACCTACCACAACTG -3'

Sequencing Primer
(F):5'- GTCTTTACACCCAAAATGTTGATGAG -3'
(R):5'- GCTCATTAACATAGGTGCTACTGC -3'
Posted On2014-10-16