Incidental Mutation 'R2252:Vwa5a'
ID241759
Institutional Source Beutler Lab
Gene Symbol Vwa5a
Ensembl Gene ENSMUSG00000023186
Gene Namevon Willebrand factor A domain containing 5A
SynonymsLoh11cr2a, 5830475I06Rik, BCSC-1
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38718268-38743337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38728080 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 369 (I369T)
Ref Sequence ENSEMBL: ENSMUSP00000113596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001544] [ENSMUST00000118144]
Predicted Effect probably damaging
Transcript: ENSMUST00000001544
AA Change: I369T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001544
Gene: ENSMUSG00000023186
AA Change: I369T

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118144
AA Change: I369T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113596
Gene: ENSMUSG00000023186
AA Change: I369T

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149376
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Vwa5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vwa5a APN 9 38737814 splice site probably null
IGL00966:Vwa5a APN 9 38723379 missense probably benign 0.24
IGL01597:Vwa5a APN 9 38733865 missense probably damaging 1.00
IGL01950:Vwa5a APN 9 38726970 missense probably damaging 1.00
IGL02008:Vwa5a APN 9 38737776 missense probably benign 0.08
IGL02326:Vwa5a APN 9 38737956 missense probably benign
IGL02378:Vwa5a APN 9 38733970 missense probably benign 0.41
IGL02442:Vwa5a APN 9 38734784 missense probably benign 0.02
IGL02458:Vwa5a APN 9 38726963 missense possibly damaging 0.79
IGL02570:Vwa5a APN 9 38734871 unclassified probably benign
IGL03068:Vwa5a APN 9 38734847 missense probably benign 0.45
R0126:Vwa5a UTSW 9 38737807 splice site probably null
R0325:Vwa5a UTSW 9 38728665 missense probably damaging 1.00
R0617:Vwa5a UTSW 9 38723895 missense probably damaging 1.00
R0928:Vwa5a UTSW 9 38728007 missense probably damaging 1.00
R1334:Vwa5a UTSW 9 38734741 missense probably benign 0.01
R1446:Vwa5a UTSW 9 38733968 missense possibly damaging 0.95
R1708:Vwa5a UTSW 9 38727832 missense probably benign
R1986:Vwa5a UTSW 9 38737814 splice site probably benign
R2024:Vwa5a UTSW 9 38736061 missense probably damaging 0.98
R2230:Vwa5a UTSW 9 38733878 missense probably null 1.00
R2278:Vwa5a UTSW 9 38723207 missense probably damaging 1.00
R3912:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R3913:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R4172:Vwa5a UTSW 9 38723870 missense probably damaging 0.98
R4244:Vwa5a UTSW 9 38737816 splice site probably benign
R4510:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4511:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4549:Vwa5a UTSW 9 38737925 missense probably benign 0.09
R4591:Vwa5a UTSW 9 38735620 missense possibly damaging 0.94
R4639:Vwa5a UTSW 9 38727114 critical splice donor site probably null
R4811:Vwa5a UTSW 9 38735953 missense probably benign 0.00
R4911:Vwa5a UTSW 9 38737972 missense probably benign 0.03
R4936:Vwa5a UTSW 9 38736198 missense probably benign 0.00
R4989:Vwa5a UTSW 9 38722630 missense probably benign 0.40
R5370:Vwa5a UTSW 9 38741216 missense probably benign 0.02
R5596:Vwa5a UTSW 9 38722578 missense probably damaging 1.00
R5914:Vwa5a UTSW 9 38741742 missense probably benign 0.00
R6207:Vwa5a UTSW 9 38722672 missense probably damaging 1.00
R6486:Vwa5a UTSW 9 38733878 missense probably null 1.00
R7666:Vwa5a UTSW 9 38733963 missense probably benign 0.06
R7683:Vwa5a UTSW 9 38734829 missense probably damaging 1.00
R7763:Vwa5a UTSW 9 38741162 missense possibly damaging 0.93
R7839:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7996:Vwa5a UTSW 9 38727828 nonsense probably null
R8024:Vwa5a UTSW 9 38736020 nonsense probably null
X0022:Vwa5a UTSW 9 38735962 missense probably damaging 1.00
X0067:Vwa5a UTSW 9 38723251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGCAGAGCTGACCTGAACC -3'
(R):5'- AGAATGCTGTCTCTGGTCTTC -3'

Sequencing Primer
(F):5'- AGCTGACCTGAACCCTGGG -3'
(R):5'- ACACAGCATTACTCAATTCTAAAAGG -3'
Posted On2014-10-16