Incidental Mutation 'R2252:Sash1'
ID241762
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8729977 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 883 (M883K)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably benign
Transcript: ENSMUST00000015449
AA Change: M883K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: M883K

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCTGAGACCCTCAAGAGACGTC -3'
(R):5'- ATCTGTCGCAGCTGTGAAACC -3'

Sequencing Primer
(F):5'- AGAGACGTCCTTGTTAAGCC -3'
(R):5'- TGTGGAAAGTTGGCCCCGATC -3'
Posted On2014-10-16