Incidental Mutation 'R2252:Pcsk1'
ID241769
Institutional Source Beutler Lab
Gene Symbol Pcsk1
Ensembl Gene ENSMUSG00000021587
Gene Nameproprotein convertase subtilisin/kexin type 1
SynonymsPC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location75089826-75134861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75126726 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 478 (A478D)
Ref Sequence ENSEMBL: ENSMUSP00000022075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022075]
PDB Structure
Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000022075
AA Change: A478D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: A478D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 6.4e-26 PFAM
Pfam:Peptidase_S8 158 442 2.2e-49 PFAM
Pfam:P_proprotein 504 591 6.1e-30 PFAM
low complexity region 679 694 N/A INTRINSIC
Pfam:Proho_convert 713 751 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222727
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Pcsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pcsk1 APN 13 75132087 missense probably benign
IGL01554:Pcsk1 APN 13 75132307 missense probably benign
IGL01960:Pcsk1 APN 13 75093167 missense possibly damaging 0.82
IGL02026:Pcsk1 APN 13 75112653 missense probably benign 0.16
IGL02047:Pcsk1 APN 13 75097989 missense probably benign 0.33
IGL02264:Pcsk1 APN 13 75105959 missense probably damaging 1.00
IGL02441:Pcsk1 APN 13 75132163 missense probably benign 0.16
IGL02795:Pcsk1 APN 13 75112620 missense probably damaging 1.00
IGL02829:Pcsk1 APN 13 75126836 missense probably damaging 1.00
IGL03116:Pcsk1 APN 13 75132216 missense probably damaging 0.99
IGL03156:Pcsk1 APN 13 75131951 missense probably benign
clipper UTSW 13 75130070 missense probably damaging 1.00
spareribs UTSW 13 75115255 missense possibly damaging 0.88
swivel UTSW 13 75125984 missense probably damaging 1.00
Tweeze UTSW 13 75126839 missense probably benign 0.00
PIT4453001:Pcsk1 UTSW 13 75112650 missense probably damaging 1.00
R0771:Pcsk1 UTSW 13 75132162 missense probably benign 0.31
R0894:Pcsk1 UTSW 13 75097977 missense probably damaging 1.00
R1014:Pcsk1 UTSW 13 75132234 missense probably damaging 1.00
R1035:Pcsk1 UTSW 13 75132119 missense probably benign
R1199:Pcsk1 UTSW 13 75096413 splice site probably benign
R1517:Pcsk1 UTSW 13 75098047 nonsense probably null
R1625:Pcsk1 UTSW 13 75126852 missense probably benign 0.11
R1691:Pcsk1 UTSW 13 75132225 missense possibly damaging 0.65
R1717:Pcsk1 UTSW 13 75110828 missense probably damaging 0.99
R2168:Pcsk1 UTSW 13 75112534 intron probably benign
R2400:Pcsk1 UTSW 13 75090126 missense probably benign 0.00
R4110:Pcsk1 UTSW 13 75096369 missense probably damaging 0.99
R4358:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4359:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4657:Pcsk1 UTSW 13 75132235 missense probably damaging 1.00
R5195:Pcsk1 UTSW 13 75126855 missense probably damaging 1.00
R5669:Pcsk1 UTSW 13 75130102 missense probably benign 0.01
R5671:Pcsk1 UTSW 13 75097907 missense possibly damaging 0.63
R5745:Pcsk1 UTSW 13 75131960 missense probably benign 0.03
R6107:Pcsk1 UTSW 13 75127848 missense probably benign 0.09
R6200:Pcsk1 UTSW 13 75115255 missense possibly damaging 0.88
R6326:Pcsk1 UTSW 13 75132179 missense possibly damaging 0.89
R6537:Pcsk1 UTSW 13 75132239 missense probably damaging 1.00
R6541:Pcsk1 UTSW 13 75125984 missense probably damaging 1.00
R6567:Pcsk1 UTSW 13 75130070 missense probably damaging 1.00
R6723:Pcsk1 UTSW 13 75093069 splice site probably null
R7258:Pcsk1 UTSW 13 75093186 missense probably damaging 1.00
R7357:Pcsk1 UTSW 13 75125960 missense probably damaging 0.96
R7487:Pcsk1 UTSW 13 75110883 missense probably benign 0.01
R7519:Pcsk1 UTSW 13 75110865 missense probably damaging 0.99
R7647:Pcsk1 UTSW 13 75132210 missense possibly damaging 0.73
R7787:Pcsk1 UTSW 13 75132158 missense possibly damaging 0.88
R7944:Pcsk1 UTSW 13 75132092 missense probably benign
R7945:Pcsk1 UTSW 13 75132092 missense probably benign
R7961:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8009:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8022:Pcsk1 UTSW 13 75099293 missense possibly damaging 0.77
R8171:Pcsk1 UTSW 13 75090091 nonsense probably null
Z1176:Pcsk1 UTSW 13 75098042 missense probably damaging 1.00
Z1177:Pcsk1 UTSW 13 75125864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATATCCTTGTCATGGACCAC -3'
(R):5'- GAGTGGTTGTTGAAGTTTACCAAC -3'

Sequencing Primer
(F):5'- GGACCACTTTTGTTGAATTGAAGAC -3'
(R):5'- TGTTGAAGTTTACCAACAGCAG -3'
Posted On2014-10-16