Incidental Mutation 'R2252:Dgkg'
ID241777
Institutional Source Beutler Lab
Gene Symbol Dgkg
Ensembl Gene ENSMUSG00000022861
Gene Namediacylglycerol kinase, gamma
SynonymsE430001K23Rik, 2900055E17Rik, Dagk3
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22468461-22657221 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 22622260 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000114441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023578] [ENSMUST00000089925] [ENSMUST00000137311]
Predicted Effect probably null
Transcript: ENSMUST00000023578
AA Change: M1K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023578
Gene: ENSMUSG00000022861
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 9.3e-66 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
DAGKc 392 516 5.29e-65 SMART
DAGKa 536 710 1.25e-116 SMART
low complexity region 735 748 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089925
AA Change: M1K

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087371
Gene: ENSMUSG00000022861
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 5 172 3.9e-54 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
C1 334 380 3.35e-3 SMART
DAGKc 431 555 5.29e-65 SMART
DAGKa 575 749 1.25e-116 SMART
low complexity region 774 787 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137311
AA Change: M1K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114441
Gene: ENSMUSG00000022861
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 3.8e-67 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150553
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the type I subfamily of diacylglycerol kinases, which are involved in lipid metabolism. These enzymes generate phosphatidic acid by catalyzing the phosphorylation of diacylglycerol, a fundamental lipid second messenger that activates numerous proteins, including protein kinase C isoforms, Ras guanyl nucleotide-releasing proteins and some transient receptor potential channels. Diacylglycerol kinase gamma has been implicated in cell cycle regulation and in the negative regulation of macrophage differentiation in leukemia cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Dgkg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Dgkg APN 16 22479362 splice site probably benign
IGL01347:Dgkg APN 16 22600590 missense probably benign 0.13
IGL02313:Dgkg APN 16 22570230 splice site probably benign
IGL02498:Dgkg APN 16 22548691 missense probably damaging 1.00
IGL02954:Dgkg APN 16 22622253 missense probably benign 0.00
IGL03103:Dgkg APN 16 22580525 missense probably damaging 1.00
R0014:Dgkg UTSW 16 22565364 splice site probably null
R0636:Dgkg UTSW 16 22579729 splice site probably benign
R0666:Dgkg UTSW 16 22562730 missense probably damaging 1.00
R1056:Dgkg UTSW 16 22600541 missense probably damaging 1.00
R1495:Dgkg UTSW 16 22500379 missense probably damaging 1.00
R1603:Dgkg UTSW 16 22570159 splice site probably benign
R1993:Dgkg UTSW 16 22600594 missense probably damaging 1.00
R2073:Dgkg UTSW 16 22565317 missense probably damaging 0.96
R2192:Dgkg UTSW 16 22588299 missense probably damaging 0.98
R2251:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R3104:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3105:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3106:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R4804:Dgkg UTSW 16 22575193 intron probably benign
R5272:Dgkg UTSW 16 22588294 splice site probably null
R5364:Dgkg UTSW 16 22600461 missense probably benign 0.03
R5417:Dgkg UTSW 16 22588331 missense possibly damaging 0.50
R5677:Dgkg UTSW 16 22570171 missense probably benign 0.00
R5839:Dgkg UTSW 16 22566494 missense possibly damaging 0.91
R5931:Dgkg UTSW 16 22558038 nonsense probably null
R6313:Dgkg UTSW 16 22519561 missense probably damaging 0.96
R7017:Dgkg UTSW 16 22572713 missense probably benign 0.31
R7135:Dgkg UTSW 16 22500382 missense probably damaging 1.00
R7326:Dgkg UTSW 16 22548690 missense probably damaging 1.00
R7476:Dgkg UTSW 16 22622304 start gained probably benign
R7812:Dgkg UTSW 16 22566415 missense probably damaging 1.00
Z1088:Dgkg UTSW 16 22469328 missense probably damaging 0.96
Z1088:Dgkg UTSW 16 22572686 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCGAGCATAAGAGTGGTTGC -3'
(R):5'- CAGCATTTCAGGATTGGCTG -3'

Sequencing Primer
(F):5'- TGGATGCAAACACTAATTCTGTG -3'
(R):5'- AGTAGCGGAAGTCCTTC -3'
Posted On2014-10-16