Incidental Mutation 'R2252:Kpna1'
ID241778
Institutional Source Beutler Lab
Gene Symbol Kpna1
Ensembl Gene ENSMUSG00000022905
Gene Namekaryopherin (importin) alpha 1
Synonymsm-importin-alpha-S1, Rch2, NPI1, mSRP1
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35978750-36037131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36021569 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 280 (Y280H)
Ref Sequence ENSEMBL: ENSMUSP00000004054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004054] [ENSMUST00000172534] [ENSMUST00000173696] [ENSMUST00000174500] [ENSMUST00000174737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004054
AA Change: Y280H

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004054
Gene: ENSMUSG00000022905
AA Change: Y280H

DomainStartEndE-ValueType
Pfam:IBB 6 104 1.3e-27 PFAM
ARM 115 156 1.47e-2 SMART
ARM 158 198 2.51e-10 SMART
ARM 200 241 7.16e-6 SMART
ARM 244 283 2.22e1 SMART
ARM 285 325 1.45e-6 SMART
ARM 327 367 1.12e-7 SMART
ARM 369 409 1.76e-5 SMART
ARM 412 452 2.91e-6 SMART
Pfam:Arm_3 466 516 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173641
SMART Domains Protein: ENSMUSP00000133664
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
ARM 16 57 7.16e-6 SMART
ARM 60 99 2.22e1 SMART
ARM 117 157 6.39e-3 SMART
Pfam:Arm_3 171 221 1.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173696
SMART Domains Protein: ENSMUSP00000134534
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 2 105 9.3e-31 PFAM
Blast:ARM 114 149 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174500
SMART Domains Protein: ENSMUSP00000133819
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 2 96 2.8e-31 PFAM
Blast:ARM 114 145 6e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174737
SMART Domains Protein: ENSMUSP00000133852
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 1 83 1.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. This protein interacts with the recombination activating gene 1 (RAG1) protein and is a putative substrate of the RAG1 ubiquitin ligase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any nervous system or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Kpna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Kpna1 APN 16 36012889 intron probably benign
IGL01653:Kpna1 APN 16 36020192 missense probably benign
IGL02412:Kpna1 APN 16 36031191 missense probably benign 0.06
IGL03102:Kpna1 APN 16 36012919 missense probably damaging 1.00
IGL03340:Kpna1 APN 16 36000246 missense probably damaging 1.00
R0040:Kpna1 UTSW 16 36023241 missense probably damaging 0.97
R0456:Kpna1 UTSW 16 36002900 missense possibly damaging 0.94
R0457:Kpna1 UTSW 16 36002905 missense probably benign 0.03
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R2225:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2226:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2227:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2251:Kpna1 UTSW 16 36021569 missense possibly damaging 0.93
R2271:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R3952:Kpna1 UTSW 16 36002882 missense probably benign 0.13
R4771:Kpna1 UTSW 16 36033403 missense probably damaging 1.00
R4954:Kpna1 UTSW 16 36033326 missense probably damaging 1.00
R5075:Kpna1 UTSW 16 36009352 missense probably damaging 1.00
R5824:Kpna1 UTSW 16 36020205 missense possibly damaging 0.91
R5873:Kpna1 UTSW 16 36014228 intron probably benign
R6221:Kpna1 UTSW 16 36020688 missense probably benign 0.02
R6603:Kpna1 UTSW 16 36029520 critical splice acceptor site probably null
R7168:Kpna1 UTSW 16 36015962 intron probably benign
R7447:Kpna1 UTSW 16 36029639 missense probably damaging 1.00
R7872:Kpna1 UTSW 16 36023195 missense probably benign 0.00
R7897:Kpna1 UTSW 16 36033865 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACTCACTCAGCGTCTGTC -3'
(R):5'- ATACCAGAGTGCTAGGGATGTG -3'

Sequencing Primer
(F):5'- ACTCAGCGTCTGTCTGTCTGG -3'
(R):5'- CCTGGATCAGAGTATACCATGCTG -3'
Posted On2014-10-16