Incidental Mutation 'R2252:Zfp472'
ID241781
Institutional Source Beutler Lab
Gene Symbol Zfp472
Ensembl Gene ENSMUSG00000053600
Gene Namezinc finger protein 472
SynonymsKrim-1, Krim-1A, Krim-1B
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32965814-32979233 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 32976283 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 69 (R69*)
Ref Sequence ENSEMBL: ENSMUSP00000036514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039132]
Predicted Effect probably null
Transcript: ENSMUST00000039132
AA Change: R69*
SMART Domains Protein: ENSMUSP00000036514
Gene: ENSMUSG00000053600
AA Change: R69*

DomainStartEndE-ValueType
KRAB 10 62 4.36e-15 SMART
ZnF_C2H2 197 219 2.45e0 SMART
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.76e-1 SMART
ZnF_C2H2 281 303 3.58e-2 SMART
ZnF_C2H2 309 331 3.29e-1 SMART
ZnF_C2H2 337 359 6.08e0 SMART
ZnF_C2H2 365 387 2.32e-1 SMART
ZnF_C2H2 393 415 6.57e-1 SMART
ZnF_C2H2 421 443 1.5e-4 SMART
ZnF_C2H2 449 471 2.2e-2 SMART
ZnF_C2H2 477 499 1.01e-1 SMART
ZnF_C2H2 505 527 8.94e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Zfp472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp472 APN 17 32977524 missense possibly damaging 0.47
IGL03012:Zfp472 APN 17 32977571 missense probably benign 0.18
IGL03184:Zfp472 APN 17 32977416 nonsense probably null
IGL03223:Zfp472 APN 17 32977274 missense probably benign 0.03
R0421:Zfp472 UTSW 17 32975923 missense possibly damaging 0.71
R0463:Zfp472 UTSW 17 32975962 missense probably damaging 0.98
R0614:Zfp472 UTSW 17 32977934 missense possibly damaging 0.53
R1348:Zfp472 UTSW 17 32977820 missense probably benign 0.44
R1557:Zfp472 UTSW 17 32975926 missense probably benign 0.32
R1630:Zfp472 UTSW 17 32977978 nonsense probably null
R1725:Zfp472 UTSW 17 32977337 missense possibly damaging 0.53
R1856:Zfp472 UTSW 17 32965913 missense possibly damaging 0.53
R1964:Zfp472 UTSW 17 32977874 missense possibly damaging 0.79
R2115:Zfp472 UTSW 17 32978014 missense possibly damaging 0.73
R2249:Zfp472 UTSW 17 32978135 missense possibly damaging 0.87
R3709:Zfp472 UTSW 17 32977711 nonsense probably null
R4119:Zfp472 UTSW 17 32978215 nonsense probably null
R4406:Zfp472 UTSW 17 32978160 missense probably benign 0.01
R4485:Zfp472 UTSW 17 32977568 missense possibly damaging 0.96
R4650:Zfp472 UTSW 17 32977657 missense possibly damaging 0.86
R4820:Zfp472 UTSW 17 32977442 missense probably benign 0.01
R5369:Zfp472 UTSW 17 32977743 missense probably damaging 0.98
R5438:Zfp472 UTSW 17 32978219 missense probably damaging 0.96
R5529:Zfp472 UTSW 17 32978433 missense possibly damaging 0.92
R5950:Zfp472 UTSW 17 32977507 missense possibly damaging 0.53
R6158:Zfp472 UTSW 17 32978389 nonsense probably null
R7012:Zfp472 UTSW 17 32977246 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTTACTTGGATGACAACAGTTG -3'
(R):5'- TGAAATGCTGTGCACAAAGG -3'

Sequencing Primer
(F):5'- GATGACAACAGTTGTTTCTTGCTC -3'
(R):5'- TGCTGTGCACAAAGGGAAGTTG -3'
Posted On2014-10-16