Incidental Mutation 'R2253:Kank4'
ID241799
Institutional Source Beutler Lab
Gene Symbol Kank4
Ensembl Gene ENSMUSG00000035407
Gene NameKN motif and ankyrin repeat domains 4
SynonymsAnkrd38
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98754898-98817537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98779226 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 328 (I328N)
Ref Sequence ENSEMBL: ENSMUSP00000099851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102790]
Predicted Effect probably damaging
Transcript: ENSMUST00000102790
AA Change: I328N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: I328N

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Kank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Kank4 APN 4 98778395 missense probably damaging 0.99
IGL02634:Kank4 APN 4 98778827 missense probably benign 0.06
IGL02883:Kank4 APN 4 98773453 missense possibly damaging 0.87
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0081:Kank4 UTSW 4 98778330 missense probably benign 0.02
R0219:Kank4 UTSW 4 98778465 missense probably benign 0.06
R0498:Kank4 UTSW 4 98779636 missense probably benign
R0609:Kank4 UTSW 4 98777105 missense probably damaging 0.99
R0855:Kank4 UTSW 4 98771444 missense probably damaging 1.00
R0865:Kank4 UTSW 4 98774663 splice site probably benign
R0961:Kank4 UTSW 4 98756519 missense probably benign 0.02
R1172:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1173:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1175:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1381:Kank4 UTSW 4 98779938 missense probably damaging 0.98
R1517:Kank4 UTSW 4 98779029 missense possibly damaging 0.83
R1573:Kank4 UTSW 4 98774836 nonsense probably null
R1668:Kank4 UTSW 4 98778896 missense probably damaging 0.98
R2051:Kank4 UTSW 4 98780102 missense probably damaging 0.99
R2656:Kank4 UTSW 4 98778957 missense probably damaging 0.99
R3801:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3802:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3804:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3945:Kank4 UTSW 4 98771280 missense probably damaging 1.00
R4172:Kank4 UTSW 4 98779121 missense probably damaging 1.00
R4502:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R4503:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R5024:Kank4 UTSW 4 98785661 missense probably damaging 0.99
R5105:Kank4 UTSW 4 98779159 missense probably benign 0.01
R5122:Kank4 UTSW 4 98756567 missense probably damaging 1.00
R5255:Kank4 UTSW 4 98778972 missense probably benign
R5484:Kank4 UTSW 4 98774785 missense probably benign
R5517:Kank4 UTSW 4 98774881 missense probably damaging 1.00
R5550:Kank4 UTSW 4 98771441 missense probably benign 0.27
R5667:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5671:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5865:Kank4 UTSW 4 98771393 missense possibly damaging 0.50
R6176:Kank4 UTSW 4 98765554 missense probably damaging 1.00
R6778:Kank4 UTSW 4 98761505 missense probably benign 0.01
R7084:Kank4 UTSW 4 98771345 missense probably damaging 1.00
R7085:Kank4 UTSW 4 98779946 missense probably benign
R7112:Kank4 UTSW 4 98761521 missense probably damaging 0.99
R8307:Kank4 UTSW 4 98778678 nonsense probably null
R8431:Kank4 UTSW 4 98779272 missense probably benign 0.33
R8447:Kank4 UTSW 4 98778492 missense probably damaging 0.99
R8483:Kank4 UTSW 4 98771378 missense probably damaging 1.00
R8505:Kank4 UTSW 4 98785676 start gained probably benign
R8805:Kank4 UTSW 4 98780036 missense possibly damaging 0.93
R8823:Kank4 UTSW 4 98780003 missense probably damaging 0.99
R8888:Kank4 UTSW 4 98765510 missense possibly damaging 0.88
R8895:Kank4 UTSW 4 98765510 missense possibly damaging 0.88
X0027:Kank4 UTSW 4 98779923 missense probably benign 0.00
Z1176:Kank4 UTSW 4 98778294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGCACTCCAGCTCTTGAATC -3'
(R):5'- CCCCATGGATCTAGAGGAAGTG -3'

Sequencing Primer
(F):5'- GAATCCTCTGTTCCCTAGCCTTGG -3'
(R):5'- TGGAAATTGAGCACCACATGAG -3'
Posted On2014-10-16