Incidental Mutation 'R2253:Slc2a5'
ID241801
Institutional Source Beutler Lab
Gene Symbol Slc2a5
Ensembl Gene ENSMUSG00000028976
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 5
SynonymsGLUT5
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150119283-150144169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150139990 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 315 (Y315H)
Ref Sequence ENSEMBL: ENSMUSP00000030826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030826
AA Change: Y315H

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030826
Gene: ENSMUSG00000028976
AA Change: Y315H

DomainStartEndE-ValueType
Pfam:MFS_1 16 397 1e-19 PFAM
Pfam:Sugar_tr 19 474 2.1e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151504
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a fructose transporter responsible for fructose uptake by the small intestine. The encoded protein also is necessary for the increase in blood pressure due to high dietary fructose consumption. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cochlear morphology and physiology with no detectable alterations in outer hair cell morphology, electromotility or nonlinear capacitance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Slc2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Slc2a5 APN 4 150125656 missense probably damaging 1.00
IGL01071:Slc2a5 APN 4 150120733 utr 5 prime probably benign
IGL01977:Slc2a5 APN 4 150142218 missense probably damaging 0.97
IGL03271:Slc2a5 APN 4 150135583 missense probably damaging 1.00
BB006:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
BB016:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R0760:Slc2a5 UTSW 4 150139667 missense probably benign
R0906:Slc2a5 UTSW 4 150142830 missense probably benign 0.21
R1099:Slc2a5 UTSW 4 150142179 missense probably benign 0.01
R1809:Slc2a5 UTSW 4 150143057 missense probably damaging 1.00
R2099:Slc2a5 UTSW 4 150143177 nonsense probably null
R2152:Slc2a5 UTSW 4 150125638 missense probably damaging 1.00
R2696:Slc2a5 UTSW 4 150120746 missense probably benign
R4835:Slc2a5 UTSW 4 150140005 missense probably benign 0.06
R4926:Slc2a5 UTSW 4 150120742 nonsense probably null
R5123:Slc2a5 UTSW 4 150139805 nonsense probably null
R5397:Slc2a5 UTSW 4 150139823 splice site probably null
R6209:Slc2a5 UTSW 4 150143100 missense probably benign 0.00
R6342:Slc2a5 UTSW 4 150139526 missense possibly damaging 0.93
R6547:Slc2a5 UTSW 4 150135619 missense possibly damaging 0.94
R7340:Slc2a5 UTSW 4 150139982 missense probably benign 0.44
R7507:Slc2a5 UTSW 4 150125650 missense probably damaging 1.00
R7537:Slc2a5 UTSW 4 150129069 missense possibly damaging 0.89
R7572:Slc2a5 UTSW 4 150142185 missense probably benign 0.33
R7751:Slc2a5 UTSW 4 150143134 missense probably damaging 1.00
R7929:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R8058:Slc2a5 UTSW 4 150143133 missense probably damaging 1.00
R8318:Slc2a5 UTSW 4 150139658 missense possibly damaging 0.90
R8477:Slc2a5 UTSW 4 150125662 missense probably benign 0.09
R8498:Slc2a5 UTSW 4 150126133 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGATTGTCCTCATGGCTGG -3'
(R):5'- TACAGCAGAGCTTTGAGGCTG -3'

Sequencing Primer
(F):5'- CAGCTGTCGGGAGTGAAC -3'
(R):5'- AGGCTGGGGCGTCAGAG -3'
Posted On2014-10-16