Incidental Mutation 'R2253:Tbc1d1'
ID241802
Institutional Source Beutler Lab
Gene Symbol Tbc1d1
Ensembl Gene ENSMUSG00000029174
Gene NameTBC1 domain family, member 1
SynonymsNob1, Nobq1, 1110062G02Rik
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location64156305-64351486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64284800 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 721 (N721S)
Ref Sequence ENSEMBL: ENSMUSP00000044577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043893] [ENSMUST00000101195] [ENSMUST00000119756] [ENSMUST00000121370]
Predicted Effect probably benign
Transcript: ENSMUST00000043893
AA Change: N721S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044577
Gene: ENSMUSG00000029174
AA Change: N721S

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 2e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 2.5e-25 PFAM
TBC 884 1104 3.84e-89 SMART
Blast:TBC 1129 1186 5e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000101195
SMART Domains Protein: ENSMUSP00000098756
Gene: ENSMUSG00000029174

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119756
SMART Domains Protein: ENSMUSP00000113643
Gene: ENSMUSG00000029174

DomainStartEndE-ValueType
PTB 39 249 5.93e-34 SMART
low complexity region 390 411 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
Pfam:DUF3350 555 610 2.9e-29 PFAM
TBC 662 882 3.84e-89 SMART
Blast:TBC 907 964 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121370
SMART Domains Protein: ENSMUSP00000112493
Gene: ENSMUSG00000029174

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147348
SMART Domains Protein: ENSMUSP00000119710
Gene: ENSMUSG00000029174

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 1e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 3.3e-29 PFAM
TBC 884 1086 2.13e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozgyous for a targeted mutation that removes exon 4 exhibit no adverse phenotype. Mice homozygous for a gene trap allele exhibit decreased body weight, resistance to diet-induced obesity, increased fat oxidization and decreased glucose uptake in the muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Tbc1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Tbc1d1 APN 5 64256992 missense probably damaging 1.00
IGL02341:Tbc1d1 APN 5 64275407 missense probably damaging 1.00
IGL02353:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02360:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02963:Tbc1d1 APN 5 64264366 missense probably damaging 1.00
IGL03003:Tbc1d1 APN 5 64316438 missense probably damaging 1.00
Betrayal UTSW 5 64173484 missense probably damaging 1.00
Perfidy UTSW 5 64335277 critical splice acceptor site probably null
R0035:Tbc1d1 UTSW 5 64256737 missense probably damaging 1.00
R0084:Tbc1d1 UTSW 5 64324454 missense probably damaging 0.96
R0321:Tbc1d1 UTSW 5 64339594 missense probably damaging 1.00
R0559:Tbc1d1 UTSW 5 64173793 missense probably damaging 1.00
R1296:Tbc1d1 UTSW 5 64264432 missense probably damaging 1.00
R1922:Tbc1d1 UTSW 5 64311221 missense probably damaging 1.00
R1928:Tbc1d1 UTSW 5 64345300 missense probably damaging 1.00
R2095:Tbc1d1 UTSW 5 64316501 missense probably benign 0.01
R2107:Tbc1d1 UTSW 5 64284705 missense probably benign 0.19
R3545:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3546:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3547:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R4039:Tbc1d1 UTSW 5 64316428 missense probably damaging 0.99
R4289:Tbc1d1 UTSW 5 64260428 missense probably damaging 1.00
R4380:Tbc1d1 UTSW 5 64333548 missense probably benign 0.29
R4405:Tbc1d1 UTSW 5 64173670 missense possibly damaging 0.93
R4564:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R4722:Tbc1d1 UTSW 5 64263557 missense probably damaging 1.00
R4779:Tbc1d1 UTSW 5 64278046 critical splice donor site probably null
R5256:Tbc1d1 UTSW 5 64282009 missense probably damaging 1.00
R5268:Tbc1d1 UTSW 5 64324567 missense probably damaging 0.99
R5510:Tbc1d1 UTSW 5 64333395 missense probably damaging 1.00
R5547:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5620:Tbc1d1 UTSW 5 64173712 missense probably benign 0.44
R5680:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5874:Tbc1d1 UTSW 5 64349930 makesense probably null
R6002:Tbc1d1 UTSW 5 64333433 missense probably damaging 1.00
R6058:Tbc1d1 UTSW 5 64278009 missense probably damaging 1.00
R6092:Tbc1d1 UTSW 5 64349899 missense probably benign 0.00
R6118:Tbc1d1 UTSW 5 64284037 missense probably damaging 0.98
R6183:Tbc1d1 UTSW 5 64275425 missense probably damaging 1.00
R6447:Tbc1d1 UTSW 5 64333493 missense probably damaging 1.00
R6824:Tbc1d1 UTSW 5 64256902 missense probably benign 0.02
R6913:Tbc1d1 UTSW 5 64311109 missense probably benign 0.26
R7039:Tbc1d1 UTSW 5 64284757 missense probably benign 0.08
R7150:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R7154:Tbc1d1 UTSW 5 64173813 missense possibly damaging 0.56
R7316:Tbc1d1 UTSW 5 64335277 critical splice acceptor site probably null
R7621:Tbc1d1 UTSW 5 64264330 missense probably damaging 1.00
R7653:Tbc1d1 UTSW 5 64256790 missense probably benign 0.21
R7684:Tbc1d1 UTSW 5 64316486 missense probably benign 0.13
R7816:Tbc1d1 UTSW 5 64349752 missense probably damaging 0.98
X0064:Tbc1d1 UTSW 5 64275452 missense probably benign 0.04
Z1088:Tbc1d1 UTSW 5 64275393 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGCCTACTTCTTAGCATCACAG -3'
(R):5'- GGCTACGTGCTTTACAAAGGG -3'

Sequencing Primer
(F):5'- GCATCACAGTGAAGAGCTTTC -3'
(R):5'- CGTGCTTTACAAAGGGCAGGG -3'
Posted On2014-10-16