Incidental Mutation 'R2253:C2cd5'
ID241808
Institutional Source Beutler Lab
Gene Symbol C2cd5
Ensembl Gene ENSMUSG00000030279
Gene NameC2 calcium-dependent domain containing 5
Synonyms5730419I09Rik, C030008B15Rik, CDP138
MMRRC Submission 040253-MU
Accession Numbers

Genbank: NM_001109688; NM_029081; NM_029897

Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location143010920-143100141 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 143036316 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 607 (Y607*)
Ref Sequence ENSEMBL: ENSMUSP00000145019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087485] [ENSMUST00000111758] [ENSMUST00000171349] [ENSMUST00000203187] [ENSMUST00000203673] [ENSMUST00000204655] [ENSMUST00000205119]
Predicted Effect probably null
Transcript: ENSMUST00000087485
AA Change: Y598*
SMART Domains Protein: ENSMUSP00000084758
Gene: ENSMUSG00000030279
AA Change: Y598*

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 350 359 N/A INTRINSIC
internal_repeat_1 381 453 3.98e-5 PROSPERO
low complexity region 637 653 N/A INTRINSIC
internal_repeat_1 909 984 3.98e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000111758
AA Change: Y598*
SMART Domains Protein: ENSMUSP00000107388
Gene: ENSMUSG00000030279
AA Change: Y598*

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000171349
AA Change: Y607*
SMART Domains Protein: ENSMUSP00000127834
Gene: ENSMUSG00000030279
AA Change: Y607*

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000203187
AA Change: Y607*
SMART Domains Protein: ENSMUSP00000145373
Gene: ENSMUSG00000030279
AA Change: Y607*

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203349
Predicted Effect probably null
Transcript: ENSMUST00000203673
AA Change: Y609*
SMART Domains Protein: ENSMUSP00000145425
Gene: ENSMUSG00000030279
AA Change: Y609*

DomainStartEndE-ValueType
C2 4 105 7.3e-18 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 361 370 N/A INTRINSIC
internal_repeat_1 392 464 4.65e-5 PROSPERO
low complexity region 648 664 N/A INTRINSIC
internal_repeat_1 971 1046 4.65e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000204655
AA Change: Y607*
SMART Domains Protein: ENSMUSP00000145019
Gene: ENSMUSG00000030279
AA Change: Y607*

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000205119
SMART Domains Protein: ENSMUSP00000145397
Gene: ENSMUSG00000030279

DomainStartEndE-ValueType
Pfam:C2 3 70 5.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in C2cd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:C2cd5 APN 6 143017945 missense probably null 0.99
IGL01065:C2cd5 APN 6 143078279 missense probably damaging 0.98
IGL01595:C2cd5 APN 6 143018022 missense probably damaging 1.00
IGL01654:C2cd5 APN 6 143081407 missense probably benign 0.06
IGL01917:C2cd5 APN 6 143072596 missense probably benign
IGL01966:C2cd5 APN 6 143012041 nonsense probably null
IGL02417:C2cd5 APN 6 143041492 missense probably damaging 1.00
IGL02616:C2cd5 APN 6 143035111 missense probably benign 0.10
IGL02745:C2cd5 APN 6 143041530 missense probably benign 0.17
IGL02819:C2cd5 APN 6 143083220 missense probably benign 0.33
IGL02926:C2cd5 APN 6 143031237 splice site probably benign
IGL02969:C2cd5 APN 6 143079943 missense probably damaging 1.00
IGL03072:C2cd5 APN 6 143079883 missense possibly damaging 0.89
IGL03226:C2cd5 APN 6 143072566 missense possibly damaging 0.86
D605:C2cd5 UTSW 6 143029660 missense probably benign 0.00
R0385:C2cd5 UTSW 6 143041490 missense probably damaging 1.00
R0497:C2cd5 UTSW 6 143012093 missense probably benign 0.00
R0644:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R0723:C2cd5 UTSW 6 143041555 splice site probably benign
R0740:C2cd5 UTSW 6 143036263 missense probably damaging 1.00
R1395:C2cd5 UTSW 6 143061738 splice site probably benign
R1475:C2cd5 UTSW 6 143072572 missense possibly damaging 0.47
R1494:C2cd5 UTSW 6 143041346 splice site probably benign
R1645:C2cd5 UTSW 6 143050126 missense probably damaging 1.00
R1928:C2cd5 UTSW 6 143013230 missense probably damaging 1.00
R3934:C2cd5 UTSW 6 143041380 missense possibly damaging 0.96
R4065:C2cd5 UTSW 6 143073671 missense probably benign
R4654:C2cd5 UTSW 6 143030184 missense probably benign 0.00
R4691:C2cd5 UTSW 6 143030148 missense possibly damaging 0.47
R4972:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R5302:C2cd5 UTSW 6 143073756 missense probably benign 0.02
R5362:C2cd5 UTSW 6 143083243 missense probably damaging 1.00
R5604:C2cd5 UTSW 6 143012021 missense probably benign 0.44
R6139:C2cd5 UTSW 6 143035058 missense probably damaging 0.97
R6165:C2cd5 UTSW 6 143050228 missense possibly damaging 0.58
R6567:C2cd5 UTSW 6 143031248 missense possibly damaging 0.86
R6600:C2cd5 UTSW 6 143079976 missense probably damaging 0.99
R6821:C2cd5 UTSW 6 143017986 missense probably damaging 1.00
R6838:C2cd5 UTSW 6 143029638 missense possibly damaging 0.68
R7153:C2cd5 UTSW 6 143019409 missense probably benign 0.04
R7689:C2cd5 UTSW 6 143050225 nonsense probably null
R8027:C2cd5 UTSW 6 143078320 missense possibly damaging 0.95
R8461:C2cd5 UTSW 6 143035076 missense probably damaging 1.00
R8852:C2cd5 UTSW 6 143083220 missense probably benign 0.33
R8860:C2cd5 UTSW 6 143083220 missense probably benign 0.33
R8863:C2cd5 UTSW 6 143041362 missense possibly damaging 0.95
X0013:C2cd5 UTSW 6 143067082 missense probably damaging 0.99
Z1177:C2cd5 UTSW 6 143029206 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGACCTGCCCTGTGTATAC -3'
(R):5'- GCAAAGTGCACATTCCTAGAC -3'

Sequencing Primer
(F):5'- ACCTGCCCTGTGTATACTGGAAG -3'
(R):5'- CTAGACATAGACCTTAAAGCCATTG -3'
Posted On2014-10-16