Incidental Mutation 'R2253:Spib'
ID241810
Institutional Source Beutler Lab
Gene Symbol Spib
Ensembl Gene ENSMUSG00000008193
Gene NameSpi-B transcription factor (Spi-1/PU.1 related)
SynonymsSpi-B
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44525993-44532071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44529968 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000096084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035323] [ENSMUST00000049343] [ENSMUST00000098483] [ENSMUST00000151793] [ENSMUST00000205506]
Predicted Effect probably benign
Transcript: ENSMUST00000035323
SMART Domains Protein: ENSMUSP00000035539
Gene: ENSMUSG00000008193

DomainStartEndE-ValueType
low complexity region 50 58 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
ETS 173 261 2.05e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049343
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098483
AA Change: S23P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096084
Gene: ENSMUSG00000008193
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
ETS 191 279 2.05e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147503
Predicted Effect probably benign
Transcript: ENSMUST00000151793
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154783
Predicted Effect probably benign
Transcript: ENSMUST00000205506
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator that binds to the PU-box (5'-GAGGAA-3') and acts as a lymphoid-specific enhancer. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice exhibit severe defects in B cell function and selective T cell-dependent humoral immune responses. Mutant B cells display a defective germinal center reaction upon immunization with DNP-KLH and proliferate poorly in vitro in responseto IgM cross-linking. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Spib
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Spib UTSW 7 44529900 missense probably damaging 1.00
R1991:Spib UTSW 7 44528857 missense probably benign 0.01
R1992:Spib UTSW 7 44528857 missense probably benign 0.01
R2267:Spib UTSW 7 44528924 missense probably benign
R4732:Spib UTSW 7 44528885 missense probably damaging 1.00
R4733:Spib UTSW 7 44528885 missense probably damaging 1.00
R5325:Spib UTSW 7 44528081 missense probably damaging 1.00
R8038:Spib UTSW 7 44529886 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCCAGAATTTGCATGGGG -3'
(R):5'- AGTTGCATACTGGACACTACC -3'

Sequencing Primer
(F):5'- TGCTGGGGGAAAGCTCC -3'
(R):5'- GGACACTACCAGGTTTCCTTGAG -3'
Posted On2014-10-16