Incidental Mutation 'R2253:Cldn24'
ID241815
Institutional Source Beutler Lab
Gene Symbol Cldn24
Ensembl Gene ENSMUSG00000061974
Gene Nameclaudin 24
SynonymsGm10107
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2253 (G1)
Quality Score92
Status Not validated
Chromosome8
Chromosomal Location47822143-47822805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47822328 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 62 (R62S)
Ref Sequence ENSEMBL: ENSMUSP00000078584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038693] [ENSMUST00000057561] [ENSMUST00000079639]
Predicted Effect probably benign
Transcript: ENSMUST00000038693
SMART Domains Protein: ENSMUSP00000041676
Gene: ENSMUSG00000038064

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 6.2e-23 PFAM
Pfam:Claudin_2 18 184 1.8e-9 PFAM
low complexity region 185 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057561
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079639
AA Change: R62S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078584
Gene: ENSMUSG00000061974
AA Change: R62S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 9.1e-25 PFAM
Pfam:Claudin_2 18 184 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212295
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is 75% identical to the human homolog. Similar to the human gene, this gene is upstream of the Cldn22 gene, which overlaps the Wwc2 gene on the opposite strand. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Cldn24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2252:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R2309:Cldn24 UTSW 8 47822739 nonsense probably null
R6265:Cldn24 UTSW 8 47822339 missense probably benign 0.00
R6818:Cldn24 UTSW 8 47822722 missense probably benign 0.03
R7688:Cldn24 UTSW 8 47822705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCATCTTCAGAACGGCCATG -3'
(R):5'- GGAACTAGCACCATGACTCC -3'

Sequencing Primer
(F):5'- CATGCAATCAGTAGGGCTTTC -3'
(R):5'- ATGACTCCCGAGGTCCAGAG -3'
Posted On2014-10-16