Incidental Mutation 'R2253:B3gnt3'
ID241817
Institutional Source Beutler Lab
Gene Symbol B3gnt3
Ensembl Gene ENSMUSG00000031803
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Synonyms2210008L19Rik
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71690756-71701789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71692818 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 302 (M302K)
Ref Sequence ENSEMBL: ENSMUSP00000034260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034260] [ENSMUST00000034261] [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably damaging
Transcript: ENSMUST00000034260
AA Change: M302K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034260
Gene: ENSMUSG00000031803
AA Change: M302K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Galactosyl_T 121 314 5.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034261
SMART Domains Protein: ENSMUSP00000034261
Gene: ENSMUSG00000079019

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
IlGF 26 120 2.46e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051995
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110012
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110013
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212491
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein and contains a signal anchor that is not cleaved. It prefers the substrates of lacto-N-tetraose and lacto-N-neotetraose, and is involved in the biosynthesis of poly-N-acetyllactosamine chains and the biosynthesis of the backbone structure of dimeric sialyl Lewis a. It plays dominant roles in L-selectin ligand biosynthesis, lymphocyte homing and lymphocyte trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display increases in thermal pain sensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in B3gnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:B3gnt3 APN 8 71693004 missense possibly damaging 0.57
R0046:B3gnt3 UTSW 8 71692923 missense probably damaging 1.00
R0046:B3gnt3 UTSW 8 71692923 missense probably damaging 1.00
R0652:B3gnt3 UTSW 8 71693822 missense probably benign 0.01
R1104:B3gnt3 UTSW 8 71693837 missense possibly damaging 0.93
R2125:B3gnt3 UTSW 8 71693358 missense probably damaging 1.00
R2132:B3gnt3 UTSW 8 71693327 missense probably damaging 1.00
R2251:B3gnt3 UTSW 8 71692818 missense probably damaging 1.00
R2252:B3gnt3 UTSW 8 71692818 missense probably damaging 1.00
R4418:B3gnt3 UTSW 8 71693769 missense probably benign 0.03
R4854:B3gnt3 UTSW 8 71692873 missense probably damaging 1.00
R4911:B3gnt3 UTSW 8 71692934 missense probably benign 0.00
R5042:B3gnt3 UTSW 8 71692888 missense probably damaging 1.00
R5778:B3gnt3 UTSW 8 71692938 missense probably benign 0.02
R6249:B3gnt3 UTSW 8 71692662 missense probably damaging 1.00
R7585:B3gnt3 UTSW 8 71693328 missense probably damaging 1.00
R7853:B3gnt3 UTSW 8 71692713 missense probably damaging 1.00
R8191:B3gnt3 UTSW 8 71693478 missense probably benign 0.06
R8734:B3gnt3 UTSW 8 71693501 missense probably damaging 0.99
Z1088:B3gnt3 UTSW 8 71693765 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGCTAGGGGATGTCAACTCC -3'
(R):5'- CGGACAACATGGTCACCTAC -3'

Sequencing Primer
(F):5'- AAACCTCTCAGTAGGCGGG -3'
(R):5'- ACCAACACCTCTTCGTGGG -3'
Posted On2014-10-16