Incidental Mutation 'R2253:Tcf25'
ID241819
Institutional Source Beutler Lab
Gene Symbol Tcf25
Ensembl Gene ENSMUSG00000001472
Gene Nametranscription factor 25 (basic helix-loop-helix)
Synonyms1100001J13Rik, Nulp1, D8Ertd325e, 1810041K11Rik
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123373753-123403835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123374033 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 54 (E54G)
Ref Sequence ENSEMBL: ENSMUSP00000148454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010298] [ENSMUST00000057934] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212404] [ENSMUST00000212470] [ENSMUST00000212569] [ENSMUST00000212571]
Predicted Effect probably benign
Transcript: ENSMUST00000010298
SMART Domains Protein: ENSMUSP00000010298
Gene: ENSMUSG00000010154

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
KIND 26 207 2.63e-82 SMART
PDB:4EFH|B 310 360 8e-8 PDB
low complexity region 419 431 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
SCOP:d1zbdb_ 540 636 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057934
AA Change: E54G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056485
Gene: ENSMUSG00000001472
AA Change: E54G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 248 588 4.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
AA Change: E54G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472
AA Change: E54G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211932
AA Change: E54G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000212404
Predicted Effect probably benign
Transcript: ENSMUST00000212470
AA Change: E54G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000212569
AA Change: E54G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000212571
AA Change: E54G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TCF25 is a member of the basic helix-loop-helix (bHLH) family of transcription factors that are important in embryonic development (Steen and Lindholm, 2008 [PubMed 18068114]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Tcf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Tcf25 APN 8 123393236 missense possibly damaging 0.87
IGL02638:Tcf25 APN 8 123399292 missense probably damaging 1.00
IGL03112:Tcf25 APN 8 123382519 splice site probably benign
R0492:Tcf25 UTSW 8 123381464 missense probably benign 0.00
R1081:Tcf25 UTSW 8 123381473 missense probably benign 0.00
R1543:Tcf25 UTSW 8 123388587 missense probably benign 0.01
R1634:Tcf25 UTSW 8 123397091 missense possibly damaging 0.68
R1662:Tcf25 UTSW 8 123381550 missense probably benign 0.00
R4326:Tcf25 UTSW 8 123401143 nonsense probably null
R4327:Tcf25 UTSW 8 123401143 nonsense probably null
R4667:Tcf25 UTSW 8 123397025 missense possibly damaging 0.89
R4977:Tcf25 UTSW 8 123388635 missense probably benign 0.03
R5248:Tcf25 UTSW 8 123373939 missense probably damaging 1.00
R5249:Tcf25 UTSW 8 123388633 missense probably damaging 1.00
R5759:Tcf25 UTSW 8 123381457 missense probably benign 0.00
R5806:Tcf25 UTSW 8 123381504 missense probably benign 0.09
R5813:Tcf25 UTSW 8 123395615 splice site probably null
R5905:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6028:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6114:Tcf25 UTSW 8 123384375 missense probably damaging 1.00
R6349:Tcf25 UTSW 8 123391593 missense probably damaging 1.00
R6904:Tcf25 UTSW 8 123400698 critical splice donor site probably null
R7232:Tcf25 UTSW 8 123401061 splice site probably null
R7287:Tcf25 UTSW 8 123373972 missense possibly damaging 0.74
RF007:Tcf25 UTSW 8 123395630 missense probably benign 0.03
Z1176:Tcf25 UTSW 8 123373906 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGAAAGCCAGCCATCTCC -3'
(R):5'- AGCAAAGTCCTGTCACTCAGC -3'

Sequencing Primer
(F):5'- CGACACGCCAATCTTGCG -3'
(R):5'- TTCCACTCGATCTCGGACGG -3'
Posted On2014-10-16