Incidental Mutation 'R2253:Gch1'
ID241829
Institutional Source Beutler Lab
Gene Symbol Gch1
Ensembl Gene ENSMUSG00000037580
Gene NameGTP cyclohydrolase 1
SynonymsGTP-CH, GTPCH
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R2253 (G1)
Quality Score159
Status Not validated
Chromosome14
Chromosomal Location47153895-47189413 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 47189341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089959]
Predicted Effect probably benign
Transcript: ENSMUST00000089959
SMART Domains Protein: ENSMUSP00000087405
Gene: ENSMUSG00000037580

DomainStartEndE-ValueType
Pfam:GTP_cyclohydroI 62 240 4e-78 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP cyclohydrolase family. The encoded protein is the first and rate-limiting enzyme in tetrahydrobiopterin (BH4) biosynthesis, catalyzing the conversion of GTP into 7,8-dihydroneopterin triphosphate. BH4 is an essential cofactor required by aromatic amino acid hydroxylases as well as nitric oxide synthases. Mutations in this gene are associated with malignant hyperphenylalaninemia and dopa-responsive dystonia. Several alternatively spliced transcript variants encoding different isoforms have been described; however, not all variants give rise to a functional enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display bradycardia, reduced L-DOPA levels and embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Gch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB004:Gch1 UTSW 14 47155923 missense probably damaging 1.00
BB014:Gch1 UTSW 14 47155923 missense probably damaging 1.00
R2251:Gch1 UTSW 14 47189341 start gained probably benign
R4201:Gch1 UTSW 14 47155803 missense probably benign 0.00
R5422:Gch1 UTSW 14 47157449 missense probably damaging 1.00
R6950:Gch1 UTSW 14 47189266 start codon destroyed probably null
R7803:Gch1 UTSW 14 47188961 missense probably benign 0.00
R7927:Gch1 UTSW 14 47155923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAAGTACTGCATGGC -3'
(R):5'- AGATCCATGACGCAAGAGGC -3'

Sequencing Primer
(F):5'- CCAGTTTGGGGAGGTTCACC -3'
(R):5'- GCTCCGGCCAATGAAAATATCTCG -3'
Posted On2014-10-16