Incidental Mutation 'R2253:Cul2'
ID241835
Institutional Source Beutler Lab
Gene Symbol Cul2
Ensembl Gene ENSMUSG00000024231
Gene Namecullin 2
Synonyms4932411N15Rik, 1300003D18Rik
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location3382988-3436377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3399876 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 3 (L3F)
Ref Sequence ENSEMBL: ENSMUSP00000123903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025073] [ENSMUST00000080089] [ENSMUST00000161317] [ENSMUST00000162301]
Predicted Effect probably damaging
Transcript: ENSMUST00000025073
AA Change: L3F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025073
Gene: ENSMUSG00000024231
AA Change: L3F

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-109 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Pfam:Cullin_Nedd8 651 700 9.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080089
AA Change: L3F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078988
Gene: ENSMUSG00000024231
AA Change: L3F

DomainStartEndE-ValueType
Pfam:Cullin 14 88 2.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161317
AA Change: L3F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123903
Gene: ENSMUSG00000024231
AA Change: L3F

DomainStartEndE-ValueType
CULLIN 353 505 1.19e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162301
AA Change: L3F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125403
Gene: ENSMUSG00000024231
AA Change: L3F

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-108 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Cullin_Nedd8 672 739 1.01e-33 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Cul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Cul2 APN 18 3423487 missense probably benign
IGL01293:Cul2 APN 18 3419426 missense probably damaging 0.99
IGL02719:Cul2 APN 18 3434052 missense probably damaging 1.00
IGL02886:Cul2 APN 18 3426920 splice site probably benign
IGL03190:Cul2 APN 18 3429634 missense possibly damaging 0.95
IGL03389:Cul2 APN 18 3431029 missense probably benign 0.00
IGL03409:Cul2 APN 18 3429593 missense probably damaging 1.00
R0238:Cul2 UTSW 18 3414115 splice site probably benign
R1013:Cul2 UTSW 18 3425535 nonsense probably null
R1119:Cul2 UTSW 18 3419335 splice site probably benign
R1743:Cul2 UTSW 18 3426851 missense probably damaging 1.00
R1897:Cul2 UTSW 18 3414164 missense probably benign
R2252:Cul2 UTSW 18 3399876 missense probably damaging 1.00
R3898:Cul2 UTSW 18 3434033 missense probably benign 0.07
R4386:Cul2 UTSW 18 3434856 missense probably damaging 1.00
R4579:Cul2 UTSW 18 3430957 missense probably benign 0.00
R4828:Cul2 UTSW 18 3431013 missense probably damaging 1.00
R6085:Cul2 UTSW 18 3431508 missense probably benign 0.01
R6429:Cul2 UTSW 18 3421345 missense probably damaging 1.00
R6480:Cul2 UTSW 18 3417561 missense possibly damaging 0.89
R6805:Cul2 UTSW 18 3421263 missense probably damaging 1.00
R6825:Cul2 UTSW 18 3434946 missense probably damaging 0.99
R7343:Cul2 UTSW 18 3426873 missense probably benign 0.08
R7690:Cul2 UTSW 18 3419420 missense probably benign 0.09
R8114:Cul2 UTSW 18 3426164 nonsense probably null
R8414:Cul2 UTSW 18 3399912 missense probably benign 0.08
R8736:Cul2 UTSW 18 3434019 missense probably damaging 0.99
R8849:Cul2 UTSW 18 3423551 missense probably benign 0.00
X0067:Cul2 UTSW 18 3419435 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GAAGCTTACCAGTCTTTCAATTCAC -3'
(R):5'- GCCTAAGGCTCTAAACTTGTTTTC -3'

Sequencing Primer
(F):5'- CATAGGAGTCCCTTGGAACTG -3'
(R):5'- GTTGCTCGCTCGACATAT -3'
Posted On2014-10-16