Incidental Mutation 'R2253:Nr3c1'
ID241836
Institutional Source Beutler Lab
Gene Symbol Nr3c1
Ensembl Gene ENSMUSG00000024431
Gene Namenuclear receptor subfamily 3, group C, member 1
SynonymsGrl-1, GR, Grl1, glucocorticoid receptor
MMRRC Submission 040253-MU
Accession Numbers

Genbank: NM_008173

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location39410545-39491301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39486751 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 161 (T161K)
Ref Sequence ENSEMBL: ENSMUSP00000120082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025300] [ENSMUST00000097592] [ENSMUST00000115567] [ENSMUST00000115571] [ENSMUST00000124115] [ENSMUST00000131885] [ENSMUST00000150483] [ENSMUST00000152853]
Predicted Effect probably benign
Transcript: ENSMUST00000025300
AA Change: T161K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025300
Gene: ENSMUSG00000024431
AA Change: T161K

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097592
AA Change: T161K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095199
Gene: ENSMUSG00000024431
AA Change: T161K

DomainStartEndE-ValueType
Pfam:GCR 27 86 9.2e-16 PFAM
Pfam:GCR 75 418 1.4e-161 PFAM
ZnF_C4 434 506 8.6e-35 SMART
HOLI 581 745 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115567
AA Change: T161K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111229
Gene: ENSMUSG00000024431
AA Change: T161K

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115571
AA Change: T161K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111233
Gene: ENSMUSG00000024431
AA Change: T161K

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124115
SMART Domains Protein: ENSMUSP00000119630
Gene: ENSMUSG00000024431

DomainStartEndE-ValueType
Pfam:GCR 27 130 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131885
Predicted Effect probably benign
Transcript: ENSMUST00000150483
Predicted Effect probably benign
Transcript: ENSMUST00000152853
AA Change: T161K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120082
Gene: ENSMUSG00000024431
AA Change: T161K

DomainStartEndE-ValueType
Pfam:GCR 27 418 5.7e-167 PFAM
ZnF_C4 434 488 5.65e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die at birth of respiratory failure with underdeveloped lungs, enlarged adrenals, elevated serum corticosterone and ACTH, and failed adrenaline synthesis. Mice with a point mutation have impaired gluconeogenesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(3) Targeted, other(8) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Nr3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nr3c1 APN 18 39428608 splice site probably null
IGL00798:Nr3c1 APN 18 39486871 missense probably damaging 1.00
IGL01527:Nr3c1 APN 18 39486637 missense probably benign 0.00
IGL02088:Nr3c1 APN 18 39424391 missense probably damaging 1.00
IGL02244:Nr3c1 APN 18 39421557 unclassified probably benign
IGL03145:Nr3c1 APN 18 39486260 missense probably damaging 1.00
IGL03236:Nr3c1 APN 18 39486391 missense probably benign 0.00
3-1:Nr3c1 UTSW 18 39486039 missense probably benign
R1296:Nr3c1 UTSW 18 39486998 nonsense probably null
R2251:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2922:Nr3c1 UTSW 18 39487103 missense possibly damaging 0.93
R4667:Nr3c1 UTSW 18 39428727 missense probably benign 0.22
R4971:Nr3c1 UTSW 18 39486877 missense probably damaging 1.00
R5106:Nr3c1 UTSW 18 39486601 missense possibly damaging 0.80
R5732:Nr3c1 UTSW 18 39415699 missense probably damaging 1.00
R5939:Nr3c1 UTSW 18 39420653 missense probably benign 0.26
R5976:Nr3c1 UTSW 18 39421549 missense probably damaging 1.00
R6091:Nr3c1 UTSW 18 39486958 small deletion probably benign
R6666:Nr3c1 UTSW 18 39487147 missense probably damaging 1.00
R7073:Nr3c1 UTSW 18 39486396 missense probably benign 0.00
R7286:Nr3c1 UTSW 18 39486460 small insertion probably benign
R7289:Nr3c1 UTSW 18 39414601 missense probably benign 0.37
R7289:Nr3c1 UTSW 18 39422733 missense probably benign 0.03
R7334:Nr3c1 UTSW 18 39487037 missense probably benign 0.00
R8550:Nr3c1 UTSW 18 39486789 missense possibly damaging 0.60
R8767:Nr3c1 UTSW 18 39486334 missense probably damaging 0.99
X0019:Nr3c1 UTSW 18 39487142 missense probably damaging 0.96
X0062:Nr3c1 UTSW 18 39428792 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCAAGGACTCTCGTTTGTC -3'
(R):5'- TCCAAAGCCGTTTCACTGTC -3'

Sequencing Primer
(F):5'- GGGACCCGGCAGAAAACTC -3'
(R):5'- AAAGCCGTTTCACTGTCCATGG -3'
Posted On2014-10-16