Incidental Mutation 'R2253:Cd248'
ID241837
Institutional Source Beutler Lab
Gene Symbol Cd248
Ensembl Gene ENSMUSG00000056481
Gene NameCD248 antigen, endosialin
SynonymsTem1, 2610111G01Rik, Cd164l1
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R2253 (G1)
Quality Score111
Status Not validated
Chromosome19
Chromosomal Location5068078-5070637 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 5068126 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000070847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070630] [ENSMUST00000140389] [ENSMUST00000151413]
Predicted Effect probably null
Transcript: ENSMUST00000070630
AA Change: M1V
SMART Domains Protein: ENSMUSP00000070847
Gene: ENSMUSG00000056481
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CLECT 22 157 1.14e-14 SMART
Blast:CCP 164 225 5e-31 BLAST
EGF 234 272 5.32e-1 SMART
EGF 274 311 2.08e-3 SMART
EGF_CA 312 351 2.92e-7 SMART
low complexity region 363 387 N/A INTRINSIC
low complexity region 478 491 N/A INTRINSIC
low complexity region 620 634 N/A INTRINSIC
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143677
Predicted Effect probably benign
Transcript: ENSMUST00000151413
SMART Domains Protein: ENSMUSP00000121084
Gene: ENSMUSG00000061451

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display decreased growth of implanted abdominal and intestinal tumors, but have normal wound healing and no gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Cd248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02413:Cd248 APN 19 5070173 missense probably damaging 0.98
solidity UTSW 19 5069355 nonsense probably null
R0130:Cd248 UTSW 19 5069962 missense probably benign
R0145:Cd248 UTSW 19 5069023 missense possibly damaging 0.85
R1589:Cd248 UTSW 19 5069932 missense probably benign 0.01
R2091:Cd248 UTSW 19 5070046 missense possibly damaging 0.84
R2381:Cd248 UTSW 19 5069193 missense possibly damaging 0.68
R2386:Cd248 UTSW 19 5069193 missense possibly damaging 0.68
R3892:Cd248 UTSW 19 5069506 missense probably damaging 0.99
R4259:Cd248 UTSW 19 5068838 missense probably damaging 0.99
R4695:Cd248 UTSW 19 5068445 missense probably damaging 0.98
R4897:Cd248 UTSW 19 5069167 missense probably benign 0.33
R4985:Cd248 UTSW 19 5069792 missense probably damaging 0.96
R5491:Cd248 UTSW 19 5070209 missense probably damaging 1.00
R5688:Cd248 UTSW 19 5069935 missense probably benign 0.01
R6301:Cd248 UTSW 19 5069981 missense probably benign 0.03
R7260:Cd248 UTSW 19 5069355 nonsense probably null
R8468:Cd248 UTSW 19 5069882 missense possibly damaging 0.76
R8824:Cd248 UTSW 19 5069617 missense probably benign 0.01
Z1177:Cd248 UTSW 19 5069165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCCCGTTAGTTGTACC -3'
(R):5'- AATCCATAGCAGCCCGTTGG -3'

Sequencing Primer
(F):5'- TTCGCCTCTCACCCCAGAAC -3'
(R):5'- ACCAGGCTGTCCACACG -3'
Posted On2014-10-16