Incidental Mutation 'R2253:Lgals12'
ID241838
Institutional Source Beutler Lab
Gene Symbol Lgals12
Ensembl Gene ENSMUSG00000024972
Gene Namelectin, galactose binding, soluble 12
SynonymsGRIP1, galectin-12, galectin-related inhibitor of proliferation
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7596660-7607193 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 7606765 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079902] [ENSMUST00000099729] [ENSMUST00000159983]
Predicted Effect probably benign
Transcript: ENSMUST00000079902
SMART Domains Protein: ENSMUSP00000078824
Gene: ENSMUSG00000024972

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 181 301 3.6e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099729
SMART Domains Protein: ENSMUSP00000097318
Gene: ENSMUSG00000024972

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159983
SMART Domains Protein: ENSMUSP00000124610
Gene: ENSMUSG00000024972

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lipolysis, reduced adiposity, and enhanced insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Lgals12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Lgals12 APN 19 7606654 splice site probably benign
IGL02630:Lgals12 APN 19 7601242 splice site probably benign
IGL02700:Lgals12 APN 19 7598090 missense probably benign 0.01
R0129:Lgals12 UTSW 19 7603038 missense probably damaging 0.99
R1398:Lgals12 UTSW 19 7603957 splice site probably benign
R1421:Lgals12 UTSW 19 7606714 missense probably benign 0.08
R1548:Lgals12 UTSW 19 7604312 missense probably benign 0.12
R1697:Lgals12 UTSW 19 7604165 missense possibly damaging 0.91
R2075:Lgals12 UTSW 19 7598845 missense possibly damaging 0.81
R2192:Lgals12 UTSW 19 7601241 splice site probably null
R4256:Lgals12 UTSW 19 7606716 missense possibly damaging 0.93
R4738:Lgals12 UTSW 19 7604099 missense probably benign 0.01
R5495:Lgals12 UTSW 19 7604130 missense probably damaging 1.00
R5810:Lgals12 UTSW 19 7606720 missense probably benign 0.00
R6139:Lgals12 UTSW 19 7604377 missense probably benign 0.07
R7414:Lgals12 UTSW 19 7603970 missense probably damaging 1.00
X0067:Lgals12 UTSW 19 7603964 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCTTCTAGCCATCTATCCCAGAAG -3'
(R):5'- TGCTGTACCATCATAGCGGG -3'

Sequencing Primer
(F):5'- CATCTATCCCAGAAGAGGCGTATTG -3'
(R):5'- ACCATCATAGCGGGGGTTG -3'
Posted On2014-10-16