Incidental Mutation 'R2253:Mbtps2'
ID241842
Institutional Source Beutler Lab
Gene Symbol Mbtps2
Ensembl Gene ENSMUSG00000046873
Gene Namemembrane-bound transcription factor peptidase, site 2
Synonyms9630032G22Rik
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2253 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location157535371-157598715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 157559033 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 270 (F270L)
Ref Sequence ENSEMBL: ENSMUSP00000059471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058098]
Predicted Effect probably benign
Transcript: ENSMUST00000058098
AA Change: F270L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000059471
Gene: ENSMUSG00000046873
AA Change: F270L

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
Pfam:Peptidase_M50 155 514 4.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065857
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a intramembrane zinc metalloprotease, which is essential in development. This protease functions in the signal protein activation involved in sterol control of transcription and the ER stress response. Mutations in this gene have been associated with ichthyosis follicularis with atrichia and photophobia (IFAP syndrome); IFAP syndrome has been quantitatively linked to a reduction in cholesterol homeostasis and ER stress response.[provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Mbtps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mbtps2 UTSW X 157568368 missense probably benign 0.01
R2251:Mbtps2 UTSW X 157559033 missense probably benign 0.03
R5365:Mbtps2 UTSW X 157568299 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGACTAGTACTTGAAGCATTGTG -3'
(R):5'- CTGCTTTGAAGAAAACTCTAAGCTG -3'

Sequencing Primer
(F):5'- GTGTCATATCAAGTAAATGCACACAC -3'
(R):5'- ACTCTAAGCTGAATGAAAAGGAATG -3'
Posted On2014-10-16